Labshake search
Citations for New England Biolabs :
3951 - 4000 of 4333 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... A linker RNA oligonucleotides purchased from IDT was preadenylated at 5’ -end by T4 RNA ligase I (NEB 0437) using a method described previously (30) ...
-
bioRxiv - Developmental Biology 2023Quote: ... tissues were then washed twice in DNAse I buffer (66mM Tris pH 7.5 and 5mM MgCl2) for 5 minutes each and then incubated with 10U DNAse (M0303L; New England Biolabs) in 100ul of DNAse buffer at 37 °C for 1hrs ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were sorted into a tube of a PCR tube strip containing 5 μL 1X CutSmart buffer (NEB, B7204S) per well ...
-
bioRxiv - Genetics 2023Quote: ... and F2 crispants were fin clipped at 5 weeks and genotyped by a T7EI assay (M0302, New England Biolabs). We extracted DNA using the Quick-DNA Microprep Kit (D3021 ...
-
bioRxiv - Developmental Biology 2023Quote: ... along with 2.5 ng/μl pCFJ90(Pmyo-2::mCherry) and 77.5 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate two independent strains expressing Ex[Pcol-10::mCherry::his-58::SL2::drl-1 cDNA] (DLS515 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 pmol of TP_MAAAPQKCAAA* mRNA (see “Toeprinting assays” section) and components of the PURExpress ΔRibosomes Kit (New England Biolabs). The reaction was incubated at 37ºC for 20 min and then diluted in 50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... then ligated to a custom 5′ adapter (10 μM oligocap) by T4 RNA Ligase I (M0437, New England Biolabs) with 1 μl RNaseOUT for 16 hours at 16°C ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was isolated and regions flanking Exon 5 were PCR-amplified using Q5 High-Fidelity DNA Polymerase (NEB) (oligonucleotide primers F ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 2.5 ng/μl pCFJ90(Pmyo-2::mCherry) and 77.5 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS327 and DLS330 strains ...
-
bioRxiv - Microbiology 2024Quote: ... The RT RNA sample (5 μL) was amplified using the LongAmp Taq 2× Master Mix (NEB, Ipswich, MA, USA) with IVT Nanopore T7 Fw and IVT Nanopore T7 Rv primers (Supplementary Table 5) ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA samples (5-500 ng) were hybridized with NEBNext rRNA Depletion Kit v2 (Cat# E7400; New England Biolabs) to diminish rRNA from the samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... A circular form of the 3I_RAN FLEXI synthetic oligonucleotide control was generated by incubating the 5’ phosphorylated-3I_RAN FLEXI oligonucleotide (500 ng) with T4 RNA Ligase I (10 U; New England Biolabs) for 2 h at 25°C and 2 min at 95°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... compatible overhangs for ligation were generated by digestion of PCR products using 5 units each of BsaI (NEB, R3733S) and DpnI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: RP library construction in brief: Footprint RNA was dephosphorylated using 5 U of T4 PNK (New England Biolabs, M0201S). Subsequently ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.5 μg each of vector pNeae2.1 and insert DNA were combined with 5 μL of 10x T4 Ligase Buffer (NEB), 5 μL of 10x rCutSmart Buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Next, the DNA adenylated oligonucleotide adenylate intermediate was de-adenylated (RNA sample, NEB Buffer 2, and 5’-deadenylase (NEB); incubation at 30 °C for 1 h ...
-
Recruitment of the m6A/Am demethylase FTO to target RNAs by the telomeric zinc finger protein ZBTB48bioRxiv - Molecular Biology 2024Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L). Protein-RNA complexes were separated using 4–12% BisTris–PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Biochemistry 2024Quote: ... unlabeled RNAs were dephosphorylated at the 5’-end by treating with calf intestinal alkaline phosphatase (CIP, New England Biolabs) for one hour at 37 °C ...
-
Recruitment of the m6A/Am demethylase FTO to target RNAs by the telomeric zinc finger protein ZBTB48bioRxiv - Molecular Biology 2024Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris–PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Cancer Biology 2024Quote: ... was used for tagmentation and amplified with Nextera Ad1_noMX and Ad2.X primers (Supplementary Table 5) using 2x Phusion high-fidelity PCR mix (NEB). AMPure beads (Beckman coulter ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 rounds of PCR were run using Q5® Hot Start High-Fidelity 2X Master Mix (NEB cat #M0494) following the manufacturer’s instructions with a 63°C annealing temperature and 30s extension ...
-
bioRxiv - Immunology 2024Quote: ... 0.5 µl of 2 µM UPA-long and 0.25 µl Phusion Hot Start Flex DNA Polymerase (New England Biolabs) were added to 15.25 µl nuclease-free water ...
-
bioRxiv - Biochemistry 2024Quote: The 9N_VRA3 adapter oligonucleotide (0139, Supplementary Table 2) was pre-adenylated with the 5’ DNA Adenylation Kit (New England Biolabs) using the following protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1–5 μg of plasmid was linearized prior to transformation using either ScaI-HF or EcoRI-HF (both NEB), respectively ...
-
bioRxiv - Genomics 2024Quote: ... uLibs remained unmodified while mLibs were methylated by mixing 250 ng of DNA with 5 µl 1.6 mM SAM (NEB), 5 µl 10x NEBuffer2 and 1 µl M.SssI (NEB ...
-
bioRxiv - Genomics 2024Quote: ... we performed PCR2 reactions (10,000gRNAs per 50ul reaction) using 5 ul of the pooled PCR1 product per reaction with Q5 polymerase (NEB). Each biological sample was amplified with PCR2 primers with unique barcodes (Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 µg of pUC19 was cleaved with EcoRI and labeled at the 5′ ends using T4 polynucleotide kinase (NEB) with [γ-32P]-ATP or at the 3′ ends using Klenow (NEB ...
-
bioRxiv - Genetics 2024Quote: ... The PCR fragments were purified using Monarch® PCR & DNA Cleanup Kit (5 μg) from New England Biolabs (NEB) Cat#T1030L ...
-
bioRxiv - Systems Biology 2024Quote: ... complete Protease Inhibitor EDTA-Free) with 5 minutes nutation and then resuspended in tagmentation buffer (1x rCutSmart Buffer NEB #B6004S ...
-
bioRxiv - Biochemistry 2024Quote: ... the free DNA fragments were purified using a Monarch PCR & DNA Cleanup Kit (5 μg) (New England Biolabs, #T1030S) and quantified ...
-
bioRxiv - Bioengineering 2022Quote: ... Processing the samples for proteomics was then continued using a 10 kDa filter aided sample preparation protocol previously published with minor modifications.[30] The proteins were digested using Lys-C enzyme (P8109S, New England Biolabs, MA, USA; 1:50) and then with trypsin (V5111 ...
-
bioRxiv - Pathology 2024Quote: ... CrRNA was synthesized from dsDNA template by overnight incubation at 37°C using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, Frankfurt am Main, Germany). Transcribed crRNA was cleaned up using Monarch@ RNA Cleanup Kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Genetics 2021Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Molecular Biology 2022Quote: The L3 DNA linker at 0.5 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using 5 U/μl of RNA Ligase Truncated K227Q (NEB) in the presence of 15% PEG8000 and 1 U/μl RNasin (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3’ RNA adaptor (/ 5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Microbiology 2022Quote: ... The total RNA recovered was split into samples of 5 μg each and enriched in poly(A) transcripts using NEBNext Poly(A) mRNA magnetic isolation module (NEB) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 400-800 fmol of nucleosomes purified from sucrose gradients was digested with a 5-25U titration of ExoIII enzyme (New England Biolabs) for 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2021Quote: ChIP sequencing libraries were built from immunoprecipitated DNA by first end repairing the DNA with 5 µL T4 DNA polymerase (NEB), 5 µL T4 PNK (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... CHART-enriched DNA was eluted twice in 200 μL elution buffer supplemented with 5 U/μL RNase H (New England BioLabs) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... aqueous phase containing the barcoded cDNA (~50 μL) was combined with 50 μL digestion mix containing 5 μL ExoI enzyme (NEB), 5 μL HinFI enzyme (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: The splint ligation reaction was performed by preparing a 5 µl mastermix that consisted of 0.5 µL Hifi Taq Ligase (NEB #M0647S), 0.5 µl 10x Taq ligase buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was PCR-amplified for 25 cycles with 5’-Cy3-labelled reverse primers (IDT) and unlabeled forward primers using either Taq polymerase or Phusion high-fidelity polymerase (NEB). PCR products were separated on 40cm tall 6% polyacrylamide denaturing gels and then visualized using a Molecular Dynamics Typhoon Scanner ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was eluted from the beads via phenol extraction or heating in water at 80oC for 5 min and ssDNA adapter [Phos]CCACGCGTGCCCTATAGTCGC[Ami] was ligated using T4 RNA ligase (NEB). Libraries were amplified and barcoded via nested and tagged PCR following the original protocol (47 ...
-
bioRxiv - Genomics 2020Quote: PCR3 was performed by subtracting 2-3 cycles from the Ct and using 2.5 uL of a mix of distinct indexed primers from the NEBNext Dual Index Kit for Illumina (New England Biolabs) using 22.5 uL PCR2 product in a 50 uL reaction volume (Q5 UltraII mastermix with EvaGreen (Biotium) ...
-
bioRxiv - Genomics 2020Quote: ... was transcribed from a sgRNA-coding PCR product with a 5′ T7 promoter sequence using HiScibe T7 Quick High yield RNA Synthesis kit (NEB). The transcription was performed at 37 °C overnight and then purified by phenol ...
-
bioRxiv - Genetics 2020Quote: ... ChIP enrichment was determined by RT-qPCR (Supplementary Table 5) prior to addition of sequencing adaptors using NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs). ATAC-seq was performed as previously described76 ...