Labshake search
Citations for New England Biolabs :
351 - 400 of 615 citations for Universal TT epitope P2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed in 20 µL reactions using Luna qPCR Universal qPCR Master Mix (New England Biolabs), 5 ng of cDNA as template ...
-
bioRxiv - Physiology 2023Quote: ... thermocycler with the Luna Universal one-step qPCR Master Mix (E3005; New England Biolabs, Ispwich, MA, USA). Amplification reactions for genes of interest were performed in 50 cycles of the following cycling protocol ...
-
bioRxiv - Microbiology 2023Quote: We performed RT-qPCR on select genes using the Luna Universal One-Step Kit (New England Biolabs) and QuantStudio 5 (Thermo) ...
-
bioRxiv - Genomics 2023Quote: ... Real-time polymerase chain reaction (PCR) was performed using Luna® Universal qPCR Master Mix (NEB M3003L) and the Bio-Rad CFX96 Touch Real-Time PCR Detection System (Bio-Rad 1845097) ...
-
bioRxiv - Microbiology 2023Quote: ... using the kit Luna® Universal qPCR Master Mix Kit (New England Biolabs, Ipswich, MA, United States). PCRs were conducted in a total volume of 20 µl containing 10 μL of Luna Universal qPCR Mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5mL of each cDNA sample was added to a Luna® Universal Probe qPCR Master Mix (NEB). 250nM of primers and probes were added to master mix ...
-
bioRxiv - Microbiology 2020Quote: ... it was performed following the instructions of Luna Universal qPCR Master Mix Kit M3003E (New England BioLabs, USA). Samples of eyelids ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA was diluted to 0.2 ng.μl-1 and 1 ng was analysed by qPCR using Luna Universal qPCR MasterMix (NEB) with 500nM of primers ...
-
bioRxiv - Developmental Biology 2019Quote: ... three biological replicates for each genotype were amplified in technical triplicate using Luna Universal qPCR Master Mix (NEB) on an Applied Biosystems StepOne Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... The RT-PCR reactions were carried out using Luna Universal qPCR Master Mix (New England Biolabs, https://www.neb.ca) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Real-time qPCR was performed using the Luna Universal Probe qPCR Master Mix (New England Biolabs, Ipswich, MA) with amplification on the Biorad CFX96 Real Time PCR Detection system ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Each reaction consisted of 10 μl of Luna Universal Probe qPCR Master Mix (New England Biolabs, Ipswich, MA), 5 μl of standard or sample ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription and qRT-PCR analysis was performed by Luna universal one- step qRT-PCR kit (NEB # E3005L) with primers list in Table 9.
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... with the New England Biolabs SYBR Green Luna® Universal qPCR Master Mix (New England Biolabs, Hitchin, UK). PCR mixtures and cycling conditions are described in Supplementary Table 7 ...
-
bioRxiv - Neuroscience 2022Quote: ... One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England BioLabs) in a total volume of 20 µl and a template concentration of 50 ng/µl according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... The qPCR was performed using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with cycling conditions of 10 min at 55°C for reverse transcription ...
-
bioRxiv - Bioengineering 2020Quote: ... The RT-PCR detection was conducted by using the Luna Universal One-Step RT-qPCR kit from NEB and following its protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was carried out on a Bio-Rad CFX96 using Luna Universal qPCR Master Mix (New England BioLabs). Primers used for qPCR were previously validated from other studies and are indicated in Supplementary Table 3.
-
bioRxiv - Developmental Biology 2020Quote: ... samples were then incubated with 0.5 μL of 50 μM Universal miRNA Cloning Linker (NEB, catalog no. S1315S) and denatured at 65°C for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... at final volume 20 μL with 10 μL of Luna Universal qPCR Master Mix (New England Biolabs, Germany). The concentration of the primers varied from 0.2-0.5 μM (for further details regarding genes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Immunology 2020Quote: ... Quantification of all other transcriptos was performed using the Luna® Universal qPCR Master Mix (New England BioLabs), on a CFX384™ Real-Time System (BIO-RAD) ...
-
bioRxiv - Genetics 2020Quote: ... CD19 gRNA expression in various organs was quantified using Luna® Universal qPCR Master Mix (NEB, Cat: M3003S). The Actinb transcript served as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... Detection of selected targets was performed with Luna® Universal One-Step RT-qPCR (New England BioLabs Inc.) according to manufacturers protocol using specific primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl 10 mM dNTPs, 0.5 μl 10 μM NEB Universal PCR primer, 0.5 μl 10 μM NEB index primer ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... quantification of relative mRNA levels of target genes was performed using the LunaR Universal qPCR Master Mix (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Ligation of universal adapters compatible with Nextera barcodes i7 and i5 was performed with T4 DNA Ligase (NEB), and Q5 Polymerase (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... The synthesized cDNA was analyzed using qPCR using Luna® Universal qPCR Master Mix (NEB, catalog number M3003). qPCR data was analyzed as previously described57.
-
bioRxiv - Bioengineering 2023Quote: All qPCR reactions were set up using 7.5 µl of 2 x Luna Universal qPCR master mix (NEB), 0.375 pmol forward primer ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis and qRT-PCR were performed simultaneously using the Luna Universal One-Step RT-qPCR kit (NEB) with the Quantstudio 7 Flex (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... cDNAs and primers (listed in Table 4) were mixed with Luna Universal qPCR Master mix (New England Biolabs) and amplification was carried out in duplicate in a CFX96 Real-Time System C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and mRNA expression was quantified by qRT-PCR using 2X Luna Universal qPCR Master Mix (New England Biolabs) on a QuantStudio 3 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA synthesis and RT-qPCR was carried out using Luna® Universal One-Step RT-qPCR Kit (NEB) according to the manufacturer’s instructions with 100 ng of mRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 12.75 μl of the diluted cDNA were mixed with 14.25 μl qPCR master mix (13.5 μl Luna Universal qPCR Master Mix (NEB) and 0.75 μl of 25 μM primer mix ...
-
bioRxiv - Genomics 2023Quote: ... RNA expression levels were quantified using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs #E3005L) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pif expression was assessed with the Luna® Universal Two-Step RT-qPCR Master Mix (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: PCR was carried out using NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, E3006) or Taqman Fast Universal PCR master mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was then directly used in the Luna® Universal One-Step RT-qPCR Kit (New England BioLabs). Primers listed in supplemental table 10.
-
bioRxiv - Microbiology 2024Quote: ... Twenty microlitre reaction mixtures were prepared using the Luna® Universal qPCR Master Mix kit (New England Biolabs) as follows ...
-
bioRxiv - Neuroscience 2024Quote: One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England Biolabs) in a total volume of 10 µl and a template concentration of 50 ng/µl according to manufacturer’s recommendation ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using Luna Universal One-Step RT-qPCR kit (New England Biolabs, Ipswich, MA, USA) according to manufacturer’s protocol using Agilent Mx3000P instrument ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified using the Luna Universal Probe Onestep RT-qPCR kit (New England Biolabs) and US CDC real-time RT-PCR primer/probe sets for 2019-nCoV_N1 ...
-
bioRxiv - Microbiology 2022Quote: ... Five microliters of the mixture was added to Luna Universal Probe One-Step RT- qPCR mixture (NEB, MA, USA) to a final volume of 20 µl ...
-
bioRxiv - Developmental Biology 2022Quote: ... and No Template Controls (NTC) for each primer pair using Luna Universal qCPR Master Mix (NEB, Ipswich, MA, #M3003) following the manufacturer’s protocol (1ul cDNA ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and RT-qPCR was performed using the Luna Universal Onestep RT-qPCR kit (New England Biolabs, Ipswich, Massachusetts, USA) on a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories Inc. ...