Labshake search
Citations for New England Biolabs :
351 - 400 of 1590 citations for Recombinant Human Long Arg3 Insulin like Growth Factor I since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: ... The resulting library was pooled into 12 separate 60 amino acid long sub-libraries (amino acids 1-60, 61-120 etc.) and combined via Gibson Assembly (NEB) with a linearized p414ADHΔter Hsp90 destination vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... surrounded by two 1kb-long homology arms upstream and downstream of the start codon of MLH1 was generated using Gibson assembly (NEB). An in vitro transcribed sgRNA targeting the region spanning the start codon of MLH1 was generated as previously described (Richardson et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 μl cDNA reaction mix was amplified by adding 25 μl of Long Amp Taq 2x Master Mix (NEB-kit), 1.25 μl SR primer for Illumina (NEB-kit) ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA samples were fractionated into small RNA (< 200 nt) and long RNA (>200nt) using the Monarch RNA cleaner (New England Biolabs). Small RNA libraries were prepared using the Small RNA-Seq Library Prep Kit (Lexogen) ...
-
bioRxiv - Biophysics 2022Quote: ... a site-specific insertion of cysteine at position 287 was achieved in the long L4 loop of Mb4-tFhuA by site-directed mutagenesis (Q5 mutagenesis kit, New England Biolabs). This cysteine-containing Mb4-tFhuA was expressed and purified as described above ...
-
bioRxiv - Genetics 2022Quote: ... DNA of Del1 and Del2 from Family 1 were used to amplify different haplotypic fragments with long-range PCR or TD-PCR (Table S17) adding restriction enzymes (MluI and KpnI, NEB) on the 3’ of primers ...
-
bioRxiv - Microbiology 2024Quote: ... 800 bp-long sequences located upstream and downstream of the Vc flagellins were amplified with Q5 2X master mix (New England Biolabs) and ligated into the restriction site XhoI and SphI in pDM4 followed by transformation of the plasmid into E ...
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant RfxCas13d proteins were expressed in E.coli NiCo21(DE3) (NEB C2529). Cells were grown in 1L of lysogeny (Luria-Bertrani ...
-
bioRxiv - Genetics 2019Quote: ... after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, USA), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... and dephosphorylated using recombinant shrimp alkaline phosphatase (New England BioLabs M0371L). Annealed and phosphorylated oligonucleotides were cloned into linearized and dephosphorylated BPK1520_puroR using T4 DNA Ligase (New England BioLabs M0202L ...
-
bioRxiv - Immunology 2021Quote: ... A similar dilution series of recombinant histone H3 (New England Biolabs) was prepared starting at 1 µg/ml protein ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 mM DTT with 1.5 µM recombinant H3 (New England Biolabs), vehicle or 500 nM recombinant enzyme ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were induced in SHuffle Express strains (New England Biolabs) upon addition of 1mM IPTG in cultures containing kanamycin 50 μg/mL and incubated with agitation at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant bacmids were created by transformation into DH10Bac competent cells (NEB), screening on XGAL plates ...
-
bioRxiv - Biochemistry 2024Quote: ... Protease Inhibitors) with recombinant PKA kinase (2500 U/mg, NEB-P600S) and 1 mM ATP overnight at 30°C and 250 rpm ...
-
bioRxiv - Cell Biology 2020Quote: ... DHB-mVenus coding sequence excised by Age I and Hpa I restriction enzymes and subcloned into pIRESneo3 (Clonetech) using AgeI and BamHI (blunted by Klenow, NEB). mUFC1 was amplified by PCR from mouse cDNA using primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The fragments were separately inserted into the same position between the restriction enzyme sites of BamH I and Kpn I (NEB) on the reconstructed pUBQ10:GFP pBI121 or original 35S:GFP pBI121 vector at the N-terminal of GFP based on a previous study (Kamiya et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA samples were subjected to DNase I treatment to avoid genomic DNA contamination using a DNase I kit [New England Biolabs (NEB), USA] following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA samples were treated by exonuclease I (NEB) at 37 °C for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... treated with DNase I (4U, New England Biolabs) and RNasin (2,5U ...
-
bioRxiv - Genomics 2020Quote: ... 2.5 units Klenow polymerase Polymerase I (NEB, M0210L)] to 50μL DNA solution at 20°C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... DNA Polymerase I Large Fragment (Klenow, NEB, M0210L), and T4 DNA ligase (Thermo Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 0.5U μl-1 I-Scel enzyme (NEB) in water were incubated at 37°C for 30 minutes and then micro-injected at a volume of approximately 2nl per embryo into lamprey embryos at the one-cell stage ...
-
bioRxiv - Molecular Biology 2021Quote: ... purified DNA was digested with I-SceI (NEB) and AvrII (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... x1 Exonuclease I Reaction Buffer (NEB, Cat #B0293), x1 CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was treated with DNAse I (NEB M0303) (1 U per 2.5 µg of RNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... and DNase I (New England Biolabs; Cat #M0303S) in physiological buffer at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was completed digested using DNase I (NEB # T2010S ...
-
bioRxiv - Molecular Biology 2019Quote: ... screened using T7 Endonuclease I (New England Biolabs), and confirmed by Sanger sequencing ...
-
bioRxiv - Genomics 2019Quote: ... 50 U Klenow polymerase Polymerase I (NEB M0210L)] ...
-
bioRxiv - Genomics 2019Quote: ... 2.5 U Klenow polymerase Polymerase I (NEB M0210L)] was added ...
-
bioRxiv - Immunology 2019Quote: ... was digested by EcoR I (NEB, Ipswich, MA) and purified ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 10 U of DNAse I (New England Biolabs), and 1 μL of 100 mg/mL RNAse A (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... treated with 2 units of DNase I (NEB) at 37°C for 1 hour followed by DNase I heat inactivation ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µL of Xmn I restriction enzyme (NEB) was added to the DSB sample and then both samples were incubated at 37°C for six hours ...
-
bioRxiv - Biochemistry 2020Quote: ... After treated with DNase I (New England Biolabs), 2 µg RNA of each condition was primed with random hexamers and converted to cDNA using SuperScript III reverse transcriptase (Thermo) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 0.5 μl of Thermolabile Exonuclease I (NEB) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 15U/mL DNase I (New England Biolabs). Protein concentration of all lysates was determined by DC Protein Assay (Bio-Rad) ...
-
bioRxiv - Genomics 2021Quote: ... 1 µl DNase I (New England Biolabs, M0303L) was added into the RNA and the mixture was incubated for 15 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... and treated with DNase I (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and treated with DNase I (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... After 1 hr of DNase I (4U, NEB) treatment in the presence of RNasin (2.5U ...
-
bioRxiv - Genomics 2022Quote: ... 10 μL of Exonuclease I (New England Biolabs), and 170 μL of nuclease-free water (Nacalai Tesque ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA templates were digested using DNase I (NEB). mRNAs were subsequently purified using a protocol that has been described previously (Figure 1B).41 Purified mRNA was suspended in 1 mM sodium citrate ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-insulin was from Sigma (I-2018) and anti-SNAP from NEB (P9310S). The coverslips were mounted on glass slides with VectaShield Antifade Mounting Medium and fixed with nail polish ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2.5 μl I-SceI enzyme (New England Biolabs R0694S ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was then treated with DNase I (NEB) following the manufacturer’s protocols and 250-500 ng of RNA was used to generate a cDNA library with MMLV H-Reverse transcriptase (Promega ...