Labshake search
Citations for New England Biolabs :
351 - 400 of 406 citations for Rabbit Anti Borrelia burgdorferi sensu stricto B31 Surface Lipoprotein P27 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... anti-glutaryl-lysine (Cell Signaling Technologies, non-commercial #14943MF and PTM-Biolabs #1151), anti-succinyl-lysine (Cell Signaling Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-succinyl-lysine (Cell Signaling Technologies, non-commercial # 13599 and PTM-Biolabs #401), anti-malonyl-lysine (Cell Signaling Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-mouse IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) were used as the secondary antibodies.
-
bioRxiv - Cell Biology 2023Quote: ... the cell–ConA bead complexes were incubated with anti- H3K9la (PTM BIOLABS, PTM1419RM) at 4°C overnight and with a secondary antibody for 1 h at room temperature ...
-
bioRxiv - Plant Biology 2023Quote: ... MBP-tagged and GST-tagged proteins were detected using anti-MBP (E8032S, NEB) and anti-GST antibody (60-021 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Anti-sense probe templates were either linearized with Sac2 (New England BioLabs #R0157S) and synthesized with SP6 RNA polymerase (Promega #P108G ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Bioengineering 2024Quote: Full length heavy and light chains for each antibody were cloned by restriction enzyme digest or Gibson Assembly (New England Biolabs) into pCMVR either individually or with a linker ...
-
bioRxiv - Neuroscience 2021Quote: ... with 3’-O-Me-m7GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at 8:1 to GTP for a capping efficiency of ∼90% ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by detection of ubiquitinated substrate by immunoblotting using anti-MBP (New England Biolabs), anti-GST and anti-ubiquitin (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were analyzed by SDS-PAGE and western blotting by using antibodies against MBP (1:1000, New England Biolabs, E8038S) or GST (1:1000 ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Microbiology 2022Quote: ... Around 100ng of the RNA was kept as input control and stored at -80°C whereas the remaining amount was subjected to immunoprecipitation using m6A specific antibody (NEB #E1610S). Initially ...
-
bioRxiv - Molecular Biology 2023Quote: ... m6A-immunoprecipitation (m6A-IP) were performed using the monoclonal m6A antibody from the EpiMark N6-Methyladenosine enrichment kit (NEB cat. E1610S). Input and eluted total RNA from m6A-IP were used to prepare libraries with Takara Pico-Input Strand-Specific Total RNA-seq for Illumina v2 (Takara) ...
-
bioRxiv - Plant Biology 2022Quote: ... the particles were captured by magnetic stand and proteins captured by the particles were separated by SDS-PAGE and examined by immunoblotting using MBP antibody (NEB, #E8032S). For the immunoblot ...
-
bioRxiv - Molecular Biology 2021Quote: ... a set of 5’-end biotinylated anti-sense DNA oligoes and 5ul RNase inhibitor (NEB) were added to the lysate ...
-
bioRxiv - Microbiology 2021Quote: ... The assay mixture was then analyzed using western blotting by anti-MBP (New England Biolabs) and anti-His (D2951 ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-Flag immobilized Mif2-6xHis-6xFlag was then treated with lambda-phosphatase (New England Biolabs) according to the manufacturer’s instruction and incubated for 2 h at 30 °C and 1200 rpm in a thermomixer ...
-
bioRxiv - Biochemistry 2023Quote: ... The anti-Flag immunoprecipitates were subject to Lambda phosphatase treatment (NEB #P0753L, Ipswich, MA, USA).
-
bioRxiv - Plant Biology 2023Quote: ... followed by detection of the ubiquitinated substrate by immunoblotting using anti-MBP (New England Biolabs), anti-GST and anti-ubiquitin (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2020Quote: Small RNA libraries were prepared from the extracted 1ug total RNA or 100ng PIWIL1-antibody-pulled down RNA using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) (NEB, Cat# E7300S) according to the manufacture’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: Amino acid sequencing and glycan localization were carried out by digesting the antibody samples with trypsin or chymotrypsin (New England Biolabs, Ipswich, MA) followed by LC-MS/MS analysis of proteolytic fragments with an Orbitrap Fusion (Thermo ...
-
bioRxiv - Molecular Biology 2021Quote: ... pH 8.0) were incubated with pre-washed pan anti-Kbhb beads (PTM Biolabs Inc., Chicago, IL) at 4 °C overnight with gentle shaking ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment(anti-sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sense and anti-sense digoxigenin labeled probes were then produced using Taq polymerase (New England Biolabs) and 40 cycles of PCR with either the sense or anti-sense primer in a Taq polymerase PCR mixture to which 0.067 mM of Digoxigenin-5-aminoallyl-dUTP (Jena Bioscience GmbH ...
-
bioRxiv - Plant Biology 2020Quote: ... The elutes were separated by 12% SDS-PAGE and subjected to immunoblotting using anti-MBP (NEB) and anti-His (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... The assay mixture was then analyzed using western blotting by anti-PanKcr (PTM-501, PTM Biolabs) and anti-H3 (ab1791 ...
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: ... pH 8.0) were incubated with pre-washed pan anti-succinyllysine (PTM-104, PTM Biolabs, Hangzhou, China) conjugated agarose beads at 4°C overnight with gentle oscillation ...
-
bioRxiv - Physiology 2022Quote: ... sense and anti-sense oligo DNAs (IDT) (Table S1) were phosphorylation using T4 Polynucleotide Kinase (NEB) at 37 °C for 30 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were blocked with 5% BSA in 1X PBS for 30 minutes at room temperature followed by subsequent incubation with primary antibodies against MBP (NEB E8032L, 1:200) and RAD51 (Proteintech 14961-1-AP ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were separated by SDS-PAGE and detected by immunoblotting using anti-MBP (New England BioLabs, E8032S), anti-GST (MBL ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound protein was detected by western blot using mouse anti-MBP diluted 1:10,000 (New England Biolabs), fluorescent secondary antibodies (Li-Cor Biosciences) ...
-
bioRxiv - Systems Biology 2023Quote: ... and the sense and anti-sense crRNA oligos were annealed and phosphorylated with T4 PNK (NEB, M0201). The linearized pRG212 vector and crRNA oligo were then ligated with T4 DNA Ligase (M0202).
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL phosphorylation mix (1µL 100mM sense oligo, 1µL 100mM anti-sense oligo, 0.5µL 25mM ATP (BioLabs #P0756S), 1µL 10X PNK T4 Buffer (BioLabs #B0201S) ...
-
bioRxiv - Plant Biology 2022Quote: ... and the ubiquitinated ERECTA_CD were detected by IB analysis with anti-MBP (E8032, 1:10,000, New England Biolabs) as primary antibody ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein amounts of OP18 and beta-actin were quantified using a primary stathmin polyclonal antibody (1:1000; Cell Signaling Technology, NEB GmbH, Frankfurt/Main, Germany) and a polyclonal beta-actin antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment (sense/anti-sense) Pceh-23_L::acy-2 fragment(sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2019Quote: ... the purified C-I30-Flag protein (30µl beads) was digested on beads (Anti-FLAG M2 affinity gel) with final 5U Enterokinase (cat#: P8070S, NEB) in the 1x EK reaction buffer (20 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... the purified C-I30-Flag protein (30µl beads) was digested on beads (Anti-FLAG M2 affinity gel) with final 10U CIP Phosphatase (cat#: M0290S, NEB) in the 1x CIP buffer (50 mM Potassium Acetate ...
-
bioRxiv - Developmental Biology 2021Quote: ... Positive clones were digested with the appropriate enzyme to linearize the plasmid and anti-sense ribonucleoprobe synthesis was carried out using Sp6 or T7 RNA polymerase (New England Biolabs)+DIG labeled UTP (Roche) ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA used in this study was capped with either m7G (Anti-Reverse Cap Analog [ARCA], S1411L) or ApppG cap analog (S1406S, New England Biolabs).
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...