Labshake search
Citations for New England Biolabs :
351 - 400 of 1947 citations for P N Nonylphenol 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... An 18-mer poly-N barcode was created by annealing primers (Table S1) and extended to make fully double stranded with Klenow polymerase (NEB). The barcode was then PCR purified (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing an N-terminal 6xHis tag and TEV site was produced in Escherichia coli NiCo21 (DE3) cells (New England Biolabs) as previously described in https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6069193/ ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations to the specificity of guides in pTREX-n-Cas9 were performed using a Q5 mutagenesis kit (NEB, Ipswich, Massachusetts). Guides targeting the ELO genes were inserted using the primers described in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... and Atd1 and containing an N-terminal TEV cleavage site were cloned directly via Gibson assembly (NEBuilder HiFi, New England Biolabs) into BamHI/NotI-digested pGEX4-1 (GE Healthcare) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was inserted into a gel-purified N-terminal sub-cloning vector digested with MluI and KpnI restriction enzymes (New England Biolabs). Cas13 C-terminal fragments were also PCR amplified out of the full Cas13 sequence templates mentioned above to contain a 5′ sequence to code for the KpnI restriction site a start codon ...
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were introduced in the N sequence by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Bioengineering 2023Quote: ... TADs were directly fused to the N-terminus to dCas9 by digesting the FLAG-NLS-MCS-linker-dCas9 plasmid with AgeI (NEB) and then cloning in PCR-amplified TADs using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... was fused in frame to the N-terminus of LRRK2 between the PreScission recognition sequence and NotI restriction site using HiFi assembly (NEB). A plasmid encoding Rab8 was previously generated in the De Camilli lab.
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... double and triple N>G mutations were introduced in the parental constructs by using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturers protocols and using custom designed primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Plant Biology 2024Quote: ... in an N-terminal fusion (MIROs are tail anchored proteins) with mCherry that was generated by Gibson assembly (New England Biolabs, Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Molecular Biology 2020Quote: 100 μl 2x LAMP master mix (NEB, E1700L),
-
bioRxiv - Genetics 2021Quote: ... in 100 μl system with CutSmart Buffer (NEB), 37°C overnight without shaking ...
-
bioRxiv - Bioengineering 2020Quote: LbCas12a (final concentration 100 nM, New England Biolabs) was incubated with 1x NEB Buffer™ 2.1 ...
-
bioRxiv - Microbiology 2020Quote: ... 100 μg of streptavidin magnetic beads (NEB, S1420S) were pre-blocked with glycogen ...
-
bioRxiv - Microbiology 2021Quote: ... L: 100 bp DNA Ladder (New England Biolabs). 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 U of DpnII restriction enzyme (NEB, R0543) was added and chromatins were digested at 37°C for overnight ...
-
bioRxiv - Microbiology 2021Quote: ... or 100 nM TMR substrate for SNAPtag (NEB) for 30 minutes at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.6 µL of 100% DMSO (NEB #12611P), with the following thermal cycle condition ...
-
bioRxiv - Microbiology 2023Quote: ... A 100 pb DNA ladder (New England Biolabs) was used as the molecular weight marker in these gels.
-
bioRxiv - Synthetic Biology 2023Quote: ... into 100 µL 10-beta electrocompetent cells (NEB), and then plated on 10 15 cm LBSpect agar plates for 16-20 h (37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 or 500 units of recombinant CK2 (NEB), 5µM or 15µM silmitaserib (CK2 inhibitor ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.6 µL of 100% DMSO (NEB #12611P), with the following thermal cycle condition ...
-
bioRxiv - Bioengineering 2024Quote: ... Approximately 100 μL of Proteinase K (NEB P8107S) digestion solution was added to each gel-containing well and incubated for ∼6 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... The flies were homogenised in 100 μl of TE-buffer pH 8 containing 1% Triton X-100 and 1% Proteinase K (NEB, P8107S). Homogenates were incubated for 3 h at 55°C followed by a 10 min incubation step at 95°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then divided into two aliquots and treated with and without 100 U M.CviPI GpC methyltransferase (100 U/million cells; New England Biolabs, M0227B-HI) supplemented with fresh 160 μM S-adenosyl-L-methionine for 15 min at 37ºC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos for side 1 and 2 were dimerized separately by mixing 9 μl of OligoA at 100 μM with 9 μl of OligoB at 100 μM and 2 μl of 10x DNA Ligase Buffer (NEB, M0202S) and heating to 95 °C for 5 minutes ...
-
bioRxiv - Physiology 2023Quote: ... 5 flies were sorted into sterile microcentrifuge tubes and homogenised in 200 µl lysis buffer (1 X TE, 1 % Triton X-100, 1/100 proteinase K (NEB, P8107S)) using a mechanical pestle ...
-
bioRxiv - Biochemistry 2024Quote: ... the crude extract containing 100 μg (in 100 μL volume) of proteins was treated with 400 units of λ-PPase (#P0753; New England Biolabs) for 60 min at 30 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10 μg/mL) and apyrase (25 mU/mL, NEB); the suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Nb35–His (10 µg/ml) and apyrase (25 mU/ml, NEB). The suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Genomics 2019Quote: ... DNA libraries were prepared at the Fundación Parque Científico de Madrid (FPCM) using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs) and purified with Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Bioengineering 2021Quote: ... the Lenti_Split-BE4-N-Blast plasmid24 was digested with restriction enzymes AgeI and BamHI (New England Biolabs (hereafter, for brevity, NEB)) and a MEGAquick-spin total fragment DNA purification kit (iNtRON Biotechnology ...
-
bioRxiv - Biochemistry 2020Quote: ... The dried glycoproteins were incubated with trypsin for 16 h at 37°C before releasing N-glycans using PNGase F (New England Biolabs, MA). Liberated N-glycans were separated from glycopeptides by C18 Sep Pak SPE cartridges (Waters Corporation ...
-
bioRxiv - Cancer Biology 2020Quote: ALC1 cDNA was cloned into a retroviral pOZ-N vector as well as in a pMSCV-puromycin vector using Gibson Assembly (NEB, E5510S) with an N-terminus FLAG-HA tag ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Microbiology 2020Quote: ... 66 and 51 bp fragments were amplified by PCR using as template the cDNA obtained from infected Arabidopsis plants with designated primer pairs introducing EcoRI at the N-terminal and XhoI (NEB, CAD) at the C-terminal end (Table S1) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was subjected to end repair and dA-tailing reaction using NEBNext End repair/dA-tailing module (NEB, cat. n°E7546S) following the manufacturer’s instruction and incubated for 5 min at 20°C and then 5 min at 65°C ...
-
bioRxiv - Microbiology 2020Quote: ... Mutations to the specificity of guides in pTREX-n-Cas9-noTags was performed using a Q5 mutagenesis kit (NEB, Ipswich, Massachusetts). Guides targeting the mitochondrial glutamate dehydrogenase (mGDH ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated by 12 % SDS-PAGE using mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...