Labshake search
Citations for New England Biolabs :
351 - 382 of 382 citations for Mouse Anti Rubella virus Glycoprotein E1 1712 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Proteins were separated through SDS-PAGE and transferred to PVDF membrane followed by incubation with anti-MBP monoclonal antibody (E8032S, NEB) and M2 Flag antibody (A8592 ...
-
bioRxiv - Immunology 2021Quote: The cDNA sequences of the paired variable heavy and light chain region of anti-RBD antibody clones were synthesized as gBlocks (IDT) and cloned by the Gibson assembly (NEB) into human IgG1 heavy chain and light chain expression plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragmented RNA was mixed with Protein G Magnetic bead prebound monoclonal anti-m6A antibody (1 µL) from the EpiMark N6-Methyladenosine Enrichment Kit (New England Biolabs), resuspended in 300 µl EpiMark IP buffer supplemented with murine RNase inhibitor (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA used in this study was capped with either m7G (Anti-Reverse Cap Analog [ARCA], S1411L) or ApppG cap analog (S1406S, New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... Bleo-treated WT-PNKP-FLAG and K226R-PNKP-FLAG cells using 10 μg of custom-made rabbit polyclonal anti-AcK226 Abs (Ez Biolabs). All other subsequent steps and buffers used for IP were the same as described earlier (17,18) ...
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated through SDS-PAGE and transferred to a PVDF membrane followed by incubation with anti-MBP monoclonal antibody (E8032S, NEB) and M2 Flag antibody (A8592 ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7). In brief ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: ... 72 h post infection (hpi) and analysed by western blotting and pan anti-succinyllysine antibody (PTM-419, PTM Biolabs, Hangzhou, China), and non-inoculated cells served as control group ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was synthesized as described (Schäfer et al., 2018) in the presence of anti-reverse cap analog (NEB or Jena Biosciences) and gel-purified ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies were diluted in the same Triton X 100 and BSA solution and suppliers and source were: primary 1:200 anti-CK20 rabbit D9Z1Z (New England Biolabs, Herts, UK), anti-CD31 mouse JC70/A (Abcam ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were washed with TBS and incubated with a horseradish peroxidase (HRP)-conjugated anti-MBP monoclonal antibody (New England Biolabs; 1:5000).
-
bioRxiv - Cell Biology 2022Quote: ... SNAP-GLP-1R and SNAP-GIPR were detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/1,000) followed by goat anti-rabbit HRP secondary (ab6271 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Membranes were incubated overnight at 4 °C with the appropriate antibody: rabbit monoclonal anti-GSK3β (1:1,000; product # 9315, Cell Signalling Technology, New England BioLabs, Whitby, Ontario, Canada), rabbit polyclonal anti-p[Ser9]GSK3β (1:500 ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoprecipitation experiments were performed with 15 μL of Pan anti-glycine lysine antibody conjugated to agarose beads (PTM Biolabs, Chicago, IL, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% Tween) with 3% BSA and then incubating the strips in 1:2000 dilution of monoclonal anti-MPB-HRP antibody (NEB, Inc, USA) in a blocking buffer for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were resolved on an 12% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membrane for detection with the following antibodies: anti-Glucocorticoid Receptor D6H2L (1:1000 dilution, Cell Signaling, New England BioLabs #12041), anti-PAX7c (1:500 dilution ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The expression of each engineered component was validated pre- and post-sort by staining Jurkat cells with an anti-Myc antibody (#2233S, NEB, MA, USA), followed by performing flow cytometry on a FACSCanto (BD Biosciences) ...
-
bioRxiv - Microbiology 2021Quote: ... The RNAs were co-transcriptionally capped with m7G anti-reverse cap analog or ApppG Cap Analog (New England Biolabs, 1411 and Cat#1406). The RNAs were purified using a Purelink RNA Mini Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Histone extracts were then resolved on a 15% polyacrylamide gel and Kac levels were determined with Western blot using anti-acetyllysine antibody (PTM Biolabs, Cat# PTM-101), with anti-Knbu/Kibu as the positive control using anti-butyryllysine antibody (PTM Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: ... The precipitates and one-fifth of the supernatant were boiled in SDS loading buffer and subjected to western blot analysis using an anti-MBP monoclonal antibody (New England Biolabs, E8032S, 1:200 dilution), followed by anti-mouse IgG-HRP (Sigma ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...