Labshake search
Citations for New England Biolabs :
351 - 400 of 4112 citations for L Phenylalanine N 1 oxo 4 1 pyrenyl butyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM EDTA] plus 1 µL 20 µg/µL lambda phage DNA (NEB, cat # N3011S) and was separated on a 6% polyacrylamide / 0.5x TBE / 1.5 mm gel for 2 hr at 110 V in a Novex electrophoresis system ...
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...
-
bioRxiv - Biophysics 2024Quote: ... a 1 μL portion of a 1 mg/mL stock of trypsin (New England Biolabs, Inc ...
-
bioRxiv - Biochemistry 2023Quote: ... buffer 4 (NEB, identical composition to rCutsmart buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Biophysics 2020Quote: ... 1 μL T4 polynucleotide kinase and 1 μL DpnI (New England Biolabs, Cats. #M0201S and R0176S) and incubated at 37°C for 1 hour ...
-
bioRxiv - Genomics 2022Quote: ... 1 μg of PCR product containing barcoded oligos were inserted into 1 μg SfiI (NEB, R0123) digested empty vector A or P by gibson assembly NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 10 mM ATP and 1 μL of T4 DNA ligase (New England Biolabs) were added and the ligation reaction was incubated for 5 cycles at 20°C for one hour followed by 37°C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM MnCl2 only or together with 1 μl Lambda Protein Phosphatase (New England Biolabs). After incubation at 30°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... Filtered (0.45 μm) supernatants were treated with 1 U/ml DNAse I (NEB; 1 h, RT) and purified through a 20% sucrose cushion (2 h ...
-
bioRxiv - Bioengineering 2022Quote: ... Then CaCl2 was added to 2mM and 1 µL (about 1 µg) of Factor Xa (NEB) was added per 50 µg of protein and the samples were left at RT for 20-24h ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 1 μM Ultramer was annealed with 1 μM T7-3G oligonucleotide in 1x Taq Buffer (NEB) in a final volume of 10 μl by heating the reaction up to 95°C for 5 minutes ...
-
bioRxiv - Pathology 2022Quote: ... and 1 mM DTT containing [3H] SAM (25:1 molar ratio of SAM(NEB, Cat#B9003S) to [methyl-3H]-SAM (PerkinElmer ...
-
bioRxiv - Zoology 2020Quote: ... Briefly: agarose plugs were pre-incubated for 1 hour with 1× Cutsmart buffer (New England Biolabs), followed by overnight incubation with 20U restriction enzymes HinfI and 20U RsaI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was then equilibrated twice in 1 ml of 1× NEBuffer 3.1 (New England Biolabs) by rotating the tube for 30 min at room temperature ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Reagents added were 1 μl of 1 mg/ml BSA (diluted from 20 mg/ml - NEB), 1 μl T4 DNA ligase buffer (NEB or Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Then 0.3 μL of 1 mg mL−1 trypsin (trypsin-ultra, MS-grade, New England Biolabs) was added and samples were incubated at 37 °C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... Filtered (0.45 µm) supernatants were treated with 1 U/ml DNAse I (NEB; 1 h, RT) and purified through a 20% sucrose cushion (2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μL T4 DNA ligase (400 U/μl) and 1 μl BsaI-HFv2 (M0202S, R3733S, NEB) and water to 15 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... The oligonucleotides were mixed at a 1:1 ratio and phosphorylated with T4 PNK (NEB, M0201) and annealed in T4 ligase buffer (NEB ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were washed in 500 µl of 1× T4 polymerase buffer (1× T4 ligase buffer (NEB) supplemented with 100 μg/ml BSA and 100 μM dNTPs (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and digested by proteinase K (New England Biolabs, 1:100 dilution to 8 units ml−1) overnight at 37°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Reagents added were 1 μl of 1 mg/ml BSA (diluted from 20 mg/ml - NEB), 1 μl T4 DNA ligase buffer (ThermoFisher/NEB) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 l of the DNA was used in a 50 l PCR reaction with the enzyme Q5 polymerase (New England Biolabs) and the primers Cytb-f AGTCCTAGTGTAATGGAAGCand Cytb-r ATCTTCAACGTGTTTAGCACC (annealing temperature 61.5°C) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 µL T4 PNK (NEB) followed by incubation for 60 min at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μl (10U) T7 endonuclease (NEB) were added to the hybridized PCR products and incubated for 15min at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 µl rSAP (NEB, Cat M0371) was then added to dephosphorylate 3’ end of DNA at 37℃ for 1hr ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µl of rSAP enzyme (NEB) and 1 µl of PNK enzyme (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 x protease inhibitor cocktail (NEB), 2 mM N-ethylmaleimide (NEM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... in 1X NEBuffer 1 (NEB #B7001) for 15 min at 37°C while shaking at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl β-agarase (NEB M0392S) was added and mixed by flicking without allowing sample to cool ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl β-agarase (NEB M0392S) was added and mixed by flicking without allowing sample to cool ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL murine RNase inhibitor (NEB), and 1 μL of 200 U/μL SuperScript III reverse transcriptase (Invitrogen).
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Vent buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl rSAP enzyme (NEB, M0371L) and 1 μl PNK enzyme (NEB ...
-
bioRxiv - Genomics 2022Quote: ... added 1 μl RecJf (NEB, M0331) and 1 μl 5’deadenylase (NEB ...
-
bioRxiv - Genomics 2020Quote: ... we added 1 μlExonuclease I (NEB), 1 μl Exonuclease III (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... HiFi Polymerase (1 unit, Phusion, NEB) in GC buffer with MgCl2 (NEB ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl T4 DNA Polymerase (NEB) and 5 μl Large (Klenow ...
-
bioRxiv - Genomics 2020Quote: ... in 1X NEBuffer 1 (NEB #B7001) at 37°C for 15 minutes ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 µL T4 Ligase Buffer (NEB) and 0.5 µL BsaI (10000 U/mL ...
-
bioRxiv - Genomics 2020Quote: ... 1 µL 10x Ligase Buffer (NEB) and 1 µL T4 DNA Ligase (NEB ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM dNTPs (New England Biolabs), 2.5 μM of each amplification primer (Additional file 1 ...
-
bioRxiv - Genetics 2020Quote: ... and sodium fluoride (NEB, 1 mM). 150uL of ice cold buffer was added to heads followed by immediate homogenization with a motorized pestle for 10 seconds on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM dNTPs (New England Biolabs), 6.67 mM DTT (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM ATP (New England Biolabs), filled to 10 μL with dH2O prepared on ice ...