Labshake search
Citations for New England Biolabs :
351 - 400 of 9272 citations for Creatinine Serum Kit 4 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Genomics 2022Quote: ... and ribosomal RNAs were depleted using ribosomal RNA depletion kit (rRNA Depletion Kit, NEB). Ribosomal depleted RNA was used to make the RNAseq libraries using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid mini-prep kit and PCR DNA clean-up kits were provided by NEB.
-
bioRxiv - Neuroscience 2019Quote: ... Fixed neurons were then permeabilized and blocked simultaneously (2% normal goat serum, 5425S, New England Biolabs, and 0.1% Triton X-100) before incubation in primary antibody solutions overnight and subsequent incubation with secondary antibodies the following day.
-
bioRxiv - Cell Biology 2019Quote: ... cells were washed with PBS and the cells were incubated in 1ml serum free medium and 250U/ml PNGase F (NEB, P0704S) for 6h ...
-
bioRxiv - Molecular Biology 2022Quote: ... MNase dilutions were prepared fresh before each digestion at 25 μg/mL in 1X bovine serum albumin (BSA) (New England Biolabs B9001S).
-
bioRxiv - Developmental Biology 2021Quote: ... using HiScribe Sp6 kit (NEB) instead of T7.
-
bioRxiv - Neuroscience 2021Quote: ... rRNA depletion kit (NEB #E6310), and Ampure XP beads (Beckman #A63881) ...
-
bioRxiv - Microbiology 2020Quote: ... the PNGase kit from (NEB) was used per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... NEBNext rRNA Depletion kit (NEB) was used to remove bacterial and eukaryotic rRNA from total RNA isolated from pooled samples ...
-
bioRxiv - Genetics 2022Quote: ... HiFi Assembly Cloning Kit (NEB) to insert the LYP1 homology sequence into the BamHI/EcoRV digest of Addgene plasmid #35121 to create the final backbone plasmid BFA0190 (Supplementary Figure 10) ...
-
bioRxiv - Genomics 2022Quote: EnGen sgRNA synthesis kit (NEB)
-
bioRxiv - Genomics 2022Quote: Monarch RNA Cleanup kit (NEB)
-
bioRxiv - Microbiology 2022Quote: ... LunaScriptTMSuperMix Kit (New England BioLabs), SYBR qPCR Master Mix (ChamQTMUniversal ...
-
bioRxiv - Microbiology 2022Quote: ... or NEBase Changer–Kit (NEB) and primers listed in supplementary Table 1 ...
-
bioRxiv - Genetics 2022Quote: ... Gibson assembly cloning kit (NEB) was applied to ligate vector and GFP∷PAB-1∷3xFLAG fragment to generate plasmid pQZ2 ...
-
bioRxiv - Microbiology 2021Quote: ... The A-Tailing Kit (NEB) was then used to add additional deoxyadenosine (A ...
-
bioRxiv - Neuroscience 2022Quote: ... Quick Ligation Kit (M2200L, NEB) was used for the ligation of these appropriate clone ...
-
bioRxiv - Biochemistry 2022Quote: ... using Q5 mutagenesis kit (NEB). N-(-42D ...
-
bioRxiv - Cell Biology 2022Quote: ... using Gibson Assembly kit (NEB). To test the interaction of KRP4 and KRP5 ...
-
bioRxiv - Microbiology 2022Quote: ... LunaScript RT SuperMix Kit (NEB) was used to generate cDNA using 1μg RNA ...
-
bioRxiv - Plant Biology 2023Quote: ... blunting (Quick Blunting kit, NEB), and re-ligating using T4 DNA Ligase (NEB).
-
bioRxiv - Biophysics 2023Quote: ... Gibson Assembly Kit (#E5510S, NEB) was used following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... Q5 DNA polymerase kit (NEB) was used to make amplicons ...
-
bioRxiv - Genomics 2023Quote: ... or RNA cleanup kit (NEB) according to manufacturer instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Monarch Plasmid MiniPrep kit (NEB) for isolating template plasmid and assembled plasmid from E ...
-
bioRxiv - Developmental Biology 2023Quote: ... The library of each plate was pooled together and the cDNA was purified using AmpureXP (New England BioLabs) beads ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using a pre-poured amylose column containing 4 mL amylose resin (New England Biolabs, E8021L) followed by size exclusion chromatography (protein buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA was first chemically fragmented (4 min) and then enzymatically treated with Antarctic Phosphatase (NEB#M0289S) and T4 Polynucleotide Kinase (NEB#M0201S) ...
-
bioRxiv - Immunology 2021Quote: ... 240 nM dT-primer* (Metabion, Planegg, Germany) and 4 U RNase Inhibitor (New England Biolabs, Frankfurt, Germany). Reverse transcription and addition of the template switch oligo was performed at 42 °C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Biochemistry 2020Quote: ... The second aliquot was incubated overnight at 37 °C with β1-4 galactosidase (New England Biolabs #P0745) using the same reaction conditions as the neuraminidase above ...
-
bioRxiv - Neuroscience 2022Quote: ... Gelated samples were digested in 4 U/ml proteinase K buffer (New England Biolabs, Ipswitch, MA, USA) with 50 mM Tris pH 8.0 (Serva ...
-
bioRxiv - Cell Biology 2022Quote: ... Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: ... was digested for 4 h at 37 °C using the restriction enzyme BbsI (#R3539S, New England Biolabs) and run on a 1 % agarose gel for 3.5 h at 100 V ...
-
bioRxiv - Developmental Biology 2021Quote: ... gently resuspended in fixation buffer (PBS, 0.1% saponin, 4% PFA, RNAsin [New England Biolabs #M0314] 1:20) and incubated for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µM gRNA pool (3 gRNAs in total) in 4× Cas9 Reaction Buffer (New England Biolabs) at 25°C for 10 min in a 5 µl reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... 4 μg of total RNA were reverse-transcribed by the M-MLV reverse transcriptase (New England BioLabs) following the manufacturer specifications and using oligo d(T ...
-
bioRxiv - Molecular Biology 2021Quote: ... Table 4 was end labeled using gamma-ATP and T4 Polynucleotide Kinase radioactive labeling protocol from NEB. Labelled oligos were purified using GE Healthcare illustra ProbeQuant G-50 Micro Columns and the membrane was probed overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were cooled to 4°C for 30 seconds and quenched with 1.2 mM unlabeled SAM (NEB) and blotted onto Hybond-XL membrane ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoprecipitation was performed overnight under rotation at 4 using 1/100 T7RNA antibody (Biolabs CB MAB-0296MC) and antiflag (Sigma F1804 and F3165) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pull-down was performed with 100 μl pre-blocked (NETS buffer with 4 mg/ml BSA (NEB) and 2 mg/ml tRNA (SigmaAldrich) ...