Labshake search
Citations for New England Biolabs :
351 - 400 of 3027 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Genomic (g)DNA was extracted from muscle biopsies (from n=27 participants) and isolated using the Monarch kit for DNA isolation (New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: DNA was isolated from 100 µL of whole blood using the blood protocol from the Monarch® Genomic DNA Purification Kit (New England Biolabs, Australia). In addition ...
-
bioRxiv - Biochemistry 2023Quote: ... was PCR amplified from pDONR221-SUMO2 plasmid (purchased from DNASU plasmid repository, United States) using Phusion® High-Fidelity DNA Polymerase (NEB, USA) with forward primer 5’ GATGGATCCATGGCCGACGAAAAG 3’ and reverse primer 5’ TTCAAGCTTTTAACCTCCCGTCTGCTG 3’ as per the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was prepared from equal amounts of RNA from each sample using Protoscript II Reverse Transcriptase (New England Biolabs Cat. No. M0368X) and an oligo dT(18 ...
-
bioRxiv - Plant Biology 2020Quote: ... mRNA was isolated with Oligo-dT Beads from NEB and RNAseq libraries were constructed with the Directional Kit from NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... restriction endonucleases and T4 DNA ligase (both from NEB). Point mutants were generated by site-directed mutagenesis using the In-Fusion HD cloning kit (TakaraBio/Clontech ...
-
bioRxiv - Developmental Biology 2021Quote: ... Subsequent cDNA was synthesized from 1μg of DNaseI (NEB) treated RNA using either High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... All other necessary enzymes were also purchased from NEB. Primers were ordered from Eurofins Genomics and Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: All restriction enzymes are ordered from NEB (Massachusetts, U.S.), including BamHI-HF (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: Restriction enzymes were purchased from New England Biolabs (NEB).
-
bioRxiv - Molecular Biology 2021Quote: ... nicked pUC19 was generated from negatively supercoiled pUC19 (NEB) by treatment with Nt.BspQI (NEB ...
-
bioRxiv - Genomics 2020Quote: ... 1 U/μl USER enzyme (both from NEB, USA), 6% v/v lymphoprep (STEMCELL Technologies ...
-
bioRxiv - Genomics 2020Quote: ... and T4 DNA ligase (both from New England Biolabs). The mixture was incubated for 10 min at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... and ligases were purchased from New England Biolabs (NEB). Antibodies were purified as described below or purchased from the following manufacturers ...
-
bioRxiv - Bioengineering 2021Quote: ... using NEBuilder HiFi DNA Assembly Cloning Kit from NEB. Synthetic DNA was purchased from IDT as gBlocks (Integrated DNA Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... Inserts were purified from a 1% agarose gel (NEB), digested with NheI-HF and SphI-HF (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was mixed with amylose resin (from NEB), pre-equilibrated with buffer-B (Buffer-A with no lysozyme ...
-
bioRxiv - Cell Biology 2022Quote: ... Sodium Orthovanadate (Vanadate) was from New England BioLabs (NEB), catalase and hydrogen peroxide (30 % ...
-
bioRxiv - Biochemistry 2022Quote: ... Cloning reagents were purchased from New England BioLabs (NEB). Codon-optimized gene fragments were purchased from Genewiz ...
-
bioRxiv - Immunology 2022Quote: ... T4 ligase and Q5 polymerase were purchased from NEB (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... Pfu DNA polymerase and Dpn1 were bought from NEB. Modified 3’-blocked dATP (dATP-CY3 ...
-
bioRxiv - Microbiology 2022Quote: ... coli strain DH5α was obtained from NEB (cat. C2987I). E ...
-
bioRxiv - Immunology 2020Quote: ... coli for plasmid propagation were purchased from NEB (#C2987H).
-
bioRxiv - Microbiology 2021Quote: ... Restriction enzymes were purchased from NEB (Ipswich, MA, USA). Inserts were generated by PCR amplification with cloning primers from Integrative DNA Technologies (Coralville ...
-
bioRxiv - Biophysics 2020Quote: ... SecYEG was obtained from E.coli BL21 (New England Biolabs) transformed with the arabinose dependent pBAD vector encoding cysteinless SecE ...
-
bioRxiv - Biochemistry 2022Quote: ... Gibson Assembly Master Mix was purchased from NEB (USA). Amicon Ultra-0.5 mL centrifugal units and Benzonase® nuclease were purchased from MilliporeSigma (USA) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Enzymes for PCR and cloning were purchased from NEB. Plasmids were cloned into either Top10 E ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and reagents were purchased from New England Biolabs (NEB) and used according to provided protocols ...
-
bioRxiv - Bioengineering 2020Quote: ... Q5 High-Fidelity PCR Kit was purchased from NEB.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Alexa Fluor 647-Phalloidin (8940) was obtained from NEB. Images were taken on an inverted confocal microscope (Leica TCS SP5 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Hi-Fi assembly from New England BioLabs (NEB) and other basic molecular cloning approaches ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All restriction enzymes and ligases were bought from NEB. MuA protein was purified in collaboration with Domus Biotechnologies (Turku ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and media were obtained from New England Biolabs (NEB) unless otherwise noted ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the GLuc2 transgene from pCMV-GLuc2 (NEB, MA, USA) was subcloned into the linearized product ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Molecular biology enzymes and kits were obtained from NEB or Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... All enzymes were obtained from New England Biolabs (NEB) and oligonucleotides were received from Integrated DNA Technologies (IDT) ...
-
bioRxiv - Biochemistry 2021Quote: ... NEB and Sigma buffers were purchased from NEB (UK) and Sigma (France) ...
-
bioRxiv - Cell Biology 2021Quote: ... with a destination vector modified from pMAL-c2 (NEB) by insertion of the Gateway cassette (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... and T4 DNA ligase from New England Biolabs (NEB). Sanger sequencing was performed by Genewiz Incorporated.
-
bioRxiv - Bioengineering 2020Quote: ... we used the proof-reading enzyme Q5 from NEB, with its included buffer ...
-
bioRxiv - Microbiology 2021Quote: ... T4 DNA ligase and buffer were purchased from NEB. Plasmid and genomic DNA isolations were carried out with the QIAprep Spin Miniprep Kit and the DNeasy Blood & Tissue Kit (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... All REases were purchased from New England BioLabs (NEB) (Ipswich ...
-
bioRxiv - Microbiology 2021Quote: ... All enzymes used in cloning were obtained from NEB. Mutageneses of the VqmAPhage and VqmAVc DBDs was accomplished using the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... and deoxynucleotide solution (both from New England Biolabs, NEB). The resulting PCR product was integrated into the plasmid via the Gibson Assembly cloning system (New England Biolabs-NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... and deoxynucleotide solution (both from New England Biolabs, NEB). The resulting PCR product was integrated into the plasmid via the Gibson Assembly cloning system (New England Biolabs-NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: All enzymes were obtained from New England Biolabs (NEB). Unless otherwise noted ...
-
bioRxiv - Biophysics 2022Quote: ... doi:10.1038/nmeth.3612] Enzymes were purchased from NEB and used according to manufacturers recommendations.
-
bioRxiv - Cancer Biology 2022Quote: ... 100 U exonuclease III (both from New England Biolabs), and incubation for 60 min at 37°C and 20 min at 80°C.
-
bioRxiv - Bioengineering 2022Quote: ... and reagents were sourced from New England Biolabs (NEB) unless otherwise noted ...
-
bioRxiv - Genomics 2022Quote: ... 1 U/μl USER enzyme (both from NEB, USA), 6% v/v lymphoprep (STEMCELL Technologies ...