Labshake search
Citations for New England Biolabs :
351 - 400 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 1M MgCl2 and 2 μl of 1 U/μl Xrn1 (M0338, NEB) were added after RNase H digest ...
-
bioRxiv - Genomics 2020Quote: ... with 2 μl (5 U/μl) of Klenow fragment exo- (NEB) in a final volume of 55 μl by incubation at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl Klenow enzyme (5 units/µl, New England Biolabs, M0210S), and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were washed 3 times with PBS and permeabilized 5 min on ice with permeabilize sol (1xPBS, 1%RNAse inhibitor Ribovanadylcomplex (RVC, NEB,#S1402S), 0,5 % Triton X-100 (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... with subsequent end repair/dA-tailing reaction using Klenow Fragment (3’-5’ exo-) (NEB M0212S) and ligation with Illumina sequencing adapters using T4 DNA ligase (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... The ligation mix (5 μL of LNB, 3 μL of Quick ligase (New England Biolabs), 1.2 μL of MQ ...
-
bioRxiv - Pathology 2021Quote: ... The second strand was synthesized with Klenow Fragments (3′-5′ exo-; New England Biolabs Inc.) and complement chains of NSR primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 0.1 mM dATP and 15 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M) and incubated at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... CrPV 5’UTR-1A-GFP-3’ UTR was generated using Gibson assembly (NEB Gibson assembly). The respective mutants were generated using Site directed mutagenesis ...
-
bioRxiv - Molecular Biology 2020Quote: ... 240 μM TruSeq Universal Adapter (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’) and 0.025 U Taq DNA Polymerase (NEB) in 1X Standard Taq Reaction Buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2.0 units of Klenow Fragment (3’-5’ exo−)(New England Biolabs, Ipswich, Massachusetts, USA), total 10 μl of the mixture was incubate at 37°C for 90 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and second strand cDNA synthesis (using Klenow fragment 3’-5’ exo- [New England BioLabs, USA]) of chicken fecal samples and dust samples was performed as previously described 55 and following manufacturer’ instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μg purified DARPP-32 isoforms as well as 5 μl ATP (New England Biolabs) in kinase dilution buffer III (SignalChem ...
-
bioRxiv - Cell Biology 2022Quote: ... A18-Y260A-SDM-Rev (5’-CGTTGTGTAACCAGGAGAATG-3’) and Q5 site directed mutagenesis kit (NEB E0554). This LT3N1-GPIR-Arhgef18 vectors were further modified to substitute EGFP with 3XHA-FLAG tag ...
-
bioRxiv - Cell Biology 2022Quote: ... miRE-Rv (5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’) and Q5 Hot Start High-Fidelity DNA polymerase (NEB M049S). The final amplicon was then digested and cloned into LT3GEPIR in-between XhoI and EcoRI restriction sites as previously described2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1pmol ssDNA substrate 5’ DY782 ATTATTATTATTATTATTATTTCATTTATTTATTTATTTA-3’ (Eurofins, UK) and 0.75U uracil-DNA glycosylase (NEB) were added to 10µg protein lysate at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were 3’ dephosphorylated and 5’ phosphorylated with T4 polynucleotide kinase (T4PNK, NEB, #M0201S), and purified with RNA Clean and Concentrator-5 (Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... Nef deletion Reverse: 5’-AGATCTACAGCTGCCTTGTAAGTCATTGG-3’) using Q5® Site-Directed Mutagenesis Kit (NEB #E0554S).
-
bioRxiv - Immunology 2024Quote: ... and 0.8U/µL of Klenow Fragment (3’-5’ exo-) DNA polymerase (NEB, Cat No. M0212M). Nickase induced linear SDA was performed using 3nM (0.04U/ µL ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Molecular Biology 2024Quote: ... steps 1–3: GELase was replaced by β-agarase I (NEB). The reaction (1 U per plug ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 ml of virus was incubated with 1 ml DNase I (NEB, 2 units/ml), 4 µL DNase I buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL Rnl2KQ (NEB M0373S), water to 30 µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μl USER Enzyme (NEB) was then incubated with size-selected ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index Primers Set 3 (NEB). Amplified libraries were cleaned up using Sample Purification Beads (NEB ...
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 3 (NEB), 5 μL of α1-2,4,6 fucosidase O (2U/μl ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µL USER enzyme (NEB) were added to each sample and incubated at 37°C for 15 min and followed by a purification with 50 µL AMPure XP beads according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 μl USER Enzyme (NEB) was applied to size-selected ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 (New England Biolabs) for multiplexing ...
-
bioRxiv - Developmental Biology 2024Quote: ... exonuclease and NEBuffer 3 (NEB) were added to the library before incubation at 37 °C for 1 h ...
-
bioRxiv - Genomics 2024Quote: ... 3 µl 10x NEBuffer2 (NEB), and 18 µl ddH2O ...