Labshake search
Citations for New England Biolabs :
351 - 400 of 1960 citations for 6 Benzofurancarboxamide N 2 azabicyclo 2.2.1 hept 6 yl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Biophysics 2021Quote: ... 3 mM CaCl2 and 0.02% DDM) was incubated with 2000 units of N-glycosidase F (PNGase F) (New England BioLabs) at room temperature for 1 h ...
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The Cas9/gRNA expression construct pTREX-n-Cas9 was first modified using the Q5 mutagenesis kit (NEB, Ipswich, Massachusetts), primers 5’-CCCAAAAAGAAAAGGAAGGTTGATTAGAAGCTTATCGATACCGTCGAC-3’ and 5’-GTCCTCGACTTTTCGCTTCTTTTTCGGGTCGCCTCCCAGCTGAGA-3’ ...
-
bioRxiv - Microbiology 2019Quote: ... Pellets were resuspended in PBS and in some cases treated with N-glycosidase F (PNGase F; New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Neuroscience 2022Quote: Proteins from neuronal culture at DIV 14 were extracted as described above and treated with and without N-glycanase or endoglycosidase H according to manufacturer’s instructions (New England Biolabs). The lysates were analyzed with Western blot using LAMP1 (1:4000 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR analysis of total DNA extracted from oysters (N=60) used the high fidelity Q5 polymerase (New England Biolabs) in a total volume of 50 μL under the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning of the expression vector was performed using NEBuilder HiFi DNA Assembly Master Mix (Gibson cloning) and was performed according to manufacturer’s guidelines (cat. n° E2621L, New England Biolabs). In addition ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Genetics 2021Quote: ... 2 × 2 µg of gDNA were digested in parallel with 50 units of DpnII (NEB #R0543L) and NlaIII (NEB #R0125L ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µl T4 DNA ligase buffer and 2 µl 10 mg/ml BSA (New England Biolabs). These reactions were placed in a thermocycler with following program ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL NEBNext Bacterial rRNA depletion solution and 2 µL Probe Hybridization Buffer (NEB, CN E7850) were mixed with cells on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNase-free BSA (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM Vanadate (Sodium Orthovanadate, NEB, pre-incubated for ten minutes at 95 °C to dissociate Vanadate oligomers ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μL 10 mM dNTPs (NEB), 9 μL Nuclease-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... 2× Protoscript Buffer (New England Biolabs), 12 mM MgCl2 (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Phusion buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM Ribonucleoside Vanadyl Complex (NEB), Roche cOmplete™ ...
-
bioRxiv - Genomics 2020Quote: ... + 2 uL DpnI (New England Biolabs) + up to 100 uL water.
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl BSA (New England Biolabs), 10 μl dNTPs (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl SrfI (New England Biolabs), and MilliQ (until a volume of 50 μl) ...
-
bioRxiv - Systems Biology 2020Quote: ... 2 μL T4 ligase buffer (NEB), 1 μL BsmBI restriction enzyme (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB) or 10 units of HpaII (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB), to assess the methylation status of two CpG sites in the promoter region ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 units Phusion Polymerase (NEB)) ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μL NlaIII (NEB, R0125L) in 100 μL reaction mixture at 37 °C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 2 units RNA-free DNAse (NEB) was added and reactions left at 37°C for 30 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... and Cap 2’-O-Methyltransferase (NEB), followed by another purification by RNA Clean & Concentrator (Zymo) ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL of USER enzyme (NEB) was added directly to each purified PCR product ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 U DNAse I (NEB). Then sonicated on ice for 10 sec and boiled 15’ at 99°C after adding 25 μL of SDS-PAGE 5x loading buffer and resolved by SDS-PAGE ...
-
bioRxiv - Genomics 2019Quote: ... 2 µl of USER enzyme (NEB) was added to the purified assembly reactions and incubated at 37 °C for 15 minutes followed by 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µl Endo H (NEB P0702S) and 3 µl of G3 reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Microbiology 2020Quote: ... After 2 U RNase H (NEB) treatment for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl T4 ligase buffer (NEB), 1 μl T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Q5 buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL PNGase F (NEB # P0704) was added to the filter and incubated for 3 h at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and 2’-O-methyltransferase (NEB, M0366), following the one step protocol ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 U/mL YIPP (NEB).50 Af tRNA nucleotidyl transferase was purified with the same method and buffers as the MBP-MS2 fusion protein.38 The reaction was incubated at 37 °C for 2 hours ...