Labshake search
Citations for New England Biolabs :
351 - 400 of 7797 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... pax9el622 fish were genotyped using primers F3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and R3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and Bsrl digestion (New England Biolabs), producing digested wild-type bands (611 and 186 bp ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were rinsed three times with deionized water for 5 minutes and incubated in 1x Terminal Transferase (TdT) buffer containing 1X buffer 4 (NEB) and 2.5 μM CoCL2 for 10 minutes at room temperature in a humid chamber ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single turnover reactions were carried out as follows: 5 µM Clr4 was preincubated 5 minutes with 1 mM final S-adenosyl-methionine (liquid SAM, 3 2mM, NEB #B9003S), and varying concentrations of pSwi6 or unP Swi6 ...
-
bioRxiv - Immunology 2021Quote: ... Samples were added to second-strand synthesis mix containing 2× NEB buffer 2 (NEB), 625 nM dNTP Mixture (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 50 ng PCR product was incubated with 2 µL 10X NEBuffer 2 (NEB, B7002S) and nuclease-free water adding up to 19 µL using the following program ...
-
bioRxiv - Biochemistry 2021Quote: ... for 1 hr at 37 °C and Proteinase K (4 U; P8107S, NEB, Ipswich, MA) for another 2 hr at 55 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... each with 1 μg of gDNA first being digested with 4 U of MmeI (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL 10× Poly(A) Polymerase Reaction Buffer and 1 μL Poly(A) Polymerase (NEB) for poly(A ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were rinsed with TE and then washed with 1 ml NEB buffer 4 (NEB) 3 × 15min ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Plant Biology 2024Quote: ... A-tailed with Klenow 3’-5’ exo-(NEB), and truncated Illumina adapters were added with T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 30 min at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... α2-3,6,8,9 neuraminidase A (NEB), LB Broth (BD Difco™) ...
-
bioRxiv - Microbiology 2020Quote: ... 2) NEB Q5 (NEB M0491), 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... T4 RNA ligase 2 (NEB) and RiboLock RNase inhibitor (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... 2 U DNase I (NEB) was added to IVT mixture and further incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 1 h at 37°C and resolved on a denaturing urea polyacrylamide gel (20% ...
-
bioRxiv - Microbiology 2021Quote: ... in 1x NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL ATP (NEB, B0202S), 2 μL 10X restriction digest buffer (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Set 2 (E7500S, NEB). Quality of the final library preparation was analysed on the Bioanalyzer using the High Sensitivity DNA reagents kit and cassettes (5067-4626 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and set 2 (NEB #7500S) according to the manufacturer’s protocol with minor modifications as noted below ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of BSA (NEB), 15 μl of dNTPs 10 mM ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM ATP) (NEB) at 30 °C for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... with 2 mM MgCl2 (NEB), 0.2mM dNTPs (made in house) ...
-
bioRxiv - Genetics 2024Quote: ... 2 μl of DpnII (NEB) was added to digest the chromatin overnight at 37 °C with shaking at 900 rpm and deactivated at 65 °C for 20 min.
-
bioRxiv - Molecular Biology 2024Quote: ... 10X NEB buffer 2 (NEB) was added to 200 ng DNA and PCR products were denatured to single strands by heating at 95°C for 5 minutes ...
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 2 (NEB), 5 μL of O-glycosidase (40,000 U/μL ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL NEBuffer 2 (NEB), 2.8 µL H2O and 0.2 µL Therminator IX (NEB ...
-
bioRxiv - Genomics 2024Quote: ... in 1x NEBuffer 2 (NEB) in a final volume of 10 µL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U RNase H (NEB) was added to hydrolyze the RNA at 37°C for 15 min ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µL T4 ligase (NEB), 4 µL 10x T4 ligase buffer (NEB) ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...