Labshake search
Citations for New England Biolabs :
3901 - 3950 of 6266 citations for 7 Diethylamino 3 nitro 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... the EcoRI inverse PCR yielded a desired length of 2 kb of promoter sequence but for duck and quail less than 2 kb of the promoter was initially sequenced so inverse PCR was repeated using XbaI (R0145S, NEB, Ipswich, MA, USA).
-
bioRxiv - Neuroscience 2019Quote: ... Semi-quantitative analysis was conducted using standard PCR amplification (Q5 Hot-Start High-Fidelity DNA polymerase; NEB, Ipswich, MA, USA, and agarose (2%) gel electrophoresis ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA). The expression of each transcript was calculated according to the transcripts per million reads method ...
-
bioRxiv - Molecular Biology 2021Quote: Variants of concern (VOC) of SARS-CoV-2 were created with Q5® Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ phosphate-containing rsmY and rsmZ amplicons were then ligated to the linearized dephosphorylated L4440 vector using a 2-hour room temperature incubation with T4 DNA ligase (NEB Cat. No. M0202S) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids cleavage was conducted at 37 °C for 10 min and stopped by addition of 2×RNA loading dye (New England Biolabs, Ipswich, MA, USA). Before loading ...
-
bioRxiv - Microbiology 2022Quote: CRISPR-Cas12a reactions were carried out in 20 μL reaction volumes with 2 μL NEBuffer™ r2.1 (New England Biolabs, Ipswich, Massachusetts, USA), 500 nM crRNA ...
-
bioRxiv - Genomics 2022Quote: ... and the results (Figure 2) suggested that a combination of the rare cutter HindIII and the frequent cutter Sau3AI (New England Biolabs, NEB, Ipswich, MA) would provide restriction fragments suitable for ddRAD-Seq (150-700 bp).
-
bioRxiv - Cell Biology 2024Quote: ... and treated for 10 min at RT by RNase III enzyme (2 U of RNase III (Short Cut, New England BioLabs, Massachusetts, USA, M0245S) with 20 mM MnCl2 in 1× reaction ShortCut buffer) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and chromatin was digested overnight by adding 25 µL 10X NEBuffer 2 and 100 U Mbo I (New England Biolabs, catalog No. R0147). Digestion efficiency was confirmed by isolating DNA from a 25-µL aliquot of the suspension and performing agarose gel electrophoresis ...
-
bioRxiv - Genomics 2023Quote: LIDAR and 3’-LIDAR libraries were analyzed on a 2% agarose gel and quantified using NEBNext Library Quant Kit for Illumina (New England Biolabs, Cat. No E7630L). Libraries were sequenced on an Illumina NextSeq500.
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and produced by PCR amplification (10–13 cycles) of tagmented DNA using a NEB Next High-Fidelity 2× PCR Master Mix (New England Biolabs, Ipswich, MA, USA). DNA fragments were then purified using the MinElute PCR Purification Kit and eluted in 10 µL elution buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... The correct sequence was introduced into the destination vectors pCAMBIA1300-2× 35S [enhanced cauliflower mosaic virus (CaMV) 35S promoter] at the restriction enzyme sites BamHI and PstI (New England BioLabs, Ipswich, MA, USA). The sgRNAs were designed through CRISPR-P 2.0 (http://crispr.hzau.edu.cn/cgi-bin/CRISPR2/SCORE ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Genomics 2019Quote: ... The embryos were treated with protease (1 µL of 25 µg/µL Qiagen Protease, 1 µL of 10x NEB Buffer 4 ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Bioengineering 2024Quote: ... were mixed in molar ratio 1:1 and 0.37 pmol of total DNA was then treated by Gibson Assembly Master Mix (New England Biolabs) for 3 hours at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Annealed handles were mixed with the purified 21 kb ARS1-DNA at a molar ratio of 15:1 and ligated with T4 DNA Ligase in 1 × T4 ligase buffer (both NEB) at 16 °C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... 50 µg of BSM or 5% v/v washed erythrocytes in PBS were treated with 1:100 NA VLPs or 1:100 Arthrobacter ureafaciens NA (NeuA, New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2020Quote: ... The crRNA and tracrRNA with Alt-R modification (Integrated DNA Technologies) were annealed in a 1:1 ratio to form gRNA that was used in the Cas9 (New England Biolabs) digestion of the SMRTbell libraries ...
-
bioRxiv - Genomics 2019Quote: ... the fragmented genomic DNA was ligated with 1 µL of 10 µM phosphorylated hairpin oligo mix (1 µL of NEB T4 ligase ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μl of 1 mM BG-biotin or BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 μl of the purified axonemes in HMEEK buffer and incubated overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was cloned into NdeI-SapI site of the expression vector pTXB-1 (Table 1, New England Biolabs) with a C-terminally tagged chitin binding domain (CBD ...
-
bioRxiv - Genomics 2019Quote: ... approximately 1 ug of genomic DNA or WGA-DNA (See Suppl. Table 1) was dephosphorylated with Quick calf intestinal phosphatase (NEB) and CutSmart Buffer (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of previously assembled Cas9-RNP complex was added together with 1 μL of dATP (10 mM) and 1 μL of Taq polymerase (NEB) and incubated at 37ºC for 20 minutes and at 72ºC for five minutes for A-tailing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The L5 RNA linker at 1 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using by 1 U/ μl of RNA Ligase 1 (NEB) in the presence of 15% PEG8000 ...
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced into either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced to either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Biophysics 2022Quote: ... These SETD3 mutants were introduced to either EcoRV-digested pLenti-CMV-Puro-Dest (w118-1) or EcoRV-digested pLenti-CMVTRE3G-Puro-DEST (w811-1) by Gibson Assembly (New England Biolabs).
-
bioRxiv - Plant Biology 2021Quote: ... RNA adapters with a 5’ inverted dT modification (See Supplementary Table 1) were ligated to the DNase- treated RNA by T4 RNA ligase 1 (#M0204S, New England Biolabs) to render the canonical cleavage products not available for subsequent ligation reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM sodium ascorbate before collecting them by scraping in 1 mL of the same solution with Murine RNase Inhibitor (1:1000, NEB). Cells were collected in a microcentrifuge tube ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA was diluted 1:1 with nuclease-free water and used in Q5® High-Fidelity DNA Polymerase (NEB) reactions (as recommended by the manufacturer ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: ... 1 unit of λ-phosphatase is defined as the amount of enzyme that hydrolyzes 1 nmol of p-nitrophenyl phosphate in 1 minute at 30°C (New England Biolabs). After 45 minutes of incubation ...