Labshake search
Citations for New England Biolabs :
3851 - 3900 of 6874 citations for 7 6 7 dimethoxy 3 4 dihydroisoquinolin 1 yl 2 methyl 3 2 methylphenyl quinazolin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... The cDNA was amplified for 6-16 cycles (primers below) with Phusion Polymerase (NEB, #E0553L) and gel-purified with ZymoClean Gel DNA Recovery Kit (Genesee Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... Digestion mix (84 μl water, 10 μl 10x NEB Buffer 3.1, 6 μl Nt.BspQ1 (NEB)) was prepared and heated to 50 oC for 5 minutes ...
-
bioRxiv - Genomics 2019Quote: ... followed by the addition of 0.5 µl of 250 mM Random Primer 6 (S1230S, NEB) and 1 µl Deoxynucleotide Solution Mix (N0447 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 6 were generated by PCR amplification (Phusion High-Fidelity PCR Kit, New England Biolabs #E0553) of an oligo that includes a T7 promoter ...
-
bioRxiv - Microbiology 2021Quote: ... and 6 µg was digested with 2U/µg DNA of the restriction endonuclease Sau3AI (NEB). Ligation with 400 U of T4 DNA ligase (NEB ...
-
bioRxiv - Genomics 2019Quote: ... The samples were further digested for 6 hr by 25 U of I-SceI (NEB). I-SceI was also heat inactivated ...
-
bioRxiv - Biochemistry 2021Quote: C-terminally (His)6-tagged LukE was expressed in BL21 (DE3) Escherichia coli cells (NEB). Transformed cells were grown at 37 °C in Terrific broth supplemented with 100 μg/mL ampicillin to a density of OD600 = 0.6 ...
-
bioRxiv - Biophysics 2020Quote: ... Digestion mix (84 μl water, 10 μl 10x NEB Buffer 3.1, 6 μl Nt.BspQ1 (NEB)) was prepared and heated to 50 oC for 5 minutes ...
-
bioRxiv - Immunology 2022Quote: ... a 6-Helix construct was expressed recombinantly in BL21 (DE3) Escherichia coli (New England Biolabs). This construct was composed of three NHR and three CHR peptides with intervening glycine/serine linkers and a C-terminal hexahistidine purification tag ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 μL 20mg/ml BSA and 5 μL 400U/μl T4 DNA Ligase (NEB, M0202) overnight at 16°C (tumbling ...
-
bioRxiv - Biophysics 2024Quote: ... 55 The samples were mixed with 6 × purple loading dye without sodium dodecyl sulfate (NEB) and with 10 × TBE to make a 1 × solution ...
-
bioRxiv - Plant Biology 2024Quote: ... the cDNA was pre-amplified with 6 cycles using Phusion HF Mastermix (New England Biolabs) and size-selected using the ProNex Size-Selective Purification System (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Cell Biology 2019Quote: ... One μg of purified RNA was reverse transcribed into cDNA using the Protoscript II Reverse Transcriptase kit (New England Biolabs). Quantitative real time polymerase chain reactions (qRT-PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Microbiology 2021Quote: ... Official CDC SARS-CoV-2 N1 gene primers and TaqMan probe set were used [58] with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs):
-
bioRxiv - Molecular Biology 2021Quote: ... The mRNA abundance levels were determined using 200 ng total RNA for each sample in technical replicates using Luna Universal One-Step RT-qPCR kit (New England BioLabs) and SYBR Green as detection agent and gene-specific primers (Table S2) ...
-
bioRxiv - Cell Biology 2022Quote: ... and were assembled into pHaloTag-C1 to produce the pHalo-Baf in one-step using the Gibson Assembly Master Mix (New England Biolabs). The cGAS cDNA was amplified by the KOD One from pLPC-cGAS-Flag (Dou et al. ...
-
bioRxiv - Genomics 2020Quote: ... One microgram of DNase-treated total RNA was reverse transcribed using AMV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and a gene-specific primer for either the germline-limited gene or actin II control ...
-
bioRxiv - Microbiology 2019Quote: ... samples were diluted to 5ng/uL and used for qRT-PCR with Luna One-Step Universal qPCR kit (NEB E3005). Gene specific primers for target transcripts were used at a final concentration of 400uM with 15ng of RNA ...
-
bioRxiv - Genomics 2019Quote: ... Ligated RNA was enriched with biotin-labeled products by another round of Streptavidin bead binding and washing (two washes each of High, Binding and Low salt buffers and one wash of 1x Thermo Pol Buffer (NEB)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and poly(A) RNA was isolated using one round of selection with oligo(dT)25 magnetic beads (New England Biolabs). RNA was then subjected to fragmentation using RNA Fragmentation Reagents (ThermoFisher ...
-
bioRxiv - Pathology 2021Quote: ... β-ENaC/SCNN1B (Hs00165722_m1) and γ-ENaC/SCNN1G (Hs00168918_m1) were performed with the Luna Universal Probe One-Step RT-qPCR Kit (NEB, E3006L). Expression of each gene was normalized to 18S (Hs99999901_s1) ...
-
bioRxiv - Bioengineering 2020Quote: ... was incubated with 2 μΜ biotinylated oligo complementary to one of the two 12 nt cohesive ends in λDNA in T4 DNA ligase reaction buffer (NEB) and hybridized at 70°C for 15 min followed by cooling to 15°C over 2 h ...
-
bioRxiv - Bioengineering 2020Quote: ... We added 1 μL of the resulting DNase digestions to 10 μL RT-qPCR reactions (Luna One-Step Universal RT-qPCR Kit, New England Biolabs) containing 0.8 U/μL RNasin Plus (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... A HiFi assembly reaction was then performed to join the PCR product with the linear pEERM1 to form the assembled circular plasmid by incubating at 50 °C for one hour using NEBuilder DNA HiFi Assembly Master Mix (New England Biolabs). The HiFi reaction solution (5 μL ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed assays for the E and RNase P genes separately in 20 μL reaction volumes using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs). The final concentrations of primer and probe were 400 and 200 nM ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA was purified using the Macherey Nagel RNA extraction kit following manufacturer’s instruction and viral RNA uptake was quantified using the Luna universal One-Step RT-qPCR kit (NEB; E3005).
-
bioRxiv - Microbiology 2021Quote: ... The three PCR products were assembled as one large fragment (5’ cynX - insert - lacA3’) by Gibson Assembly (New England Biolabs). The assembled DNA was transformed into electrocompetent WT E ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified with 250 ng of RNA inputs using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs), using real-time RT-PCR primer/probe sets 2019-nCoV_N1 (CDCN1 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 4μL purified RNA were subsequently used for RT-qPCR reaction using the Luna Universal One-Step RT-qPCR kit (New England Biolabs) and 0.4μM of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning and screening PCR reactions were performed using Q5 High-Fidelity DNA and One-Taq DNA polymerases (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then diluted to 20 ng/uL and 20-60 ng of RNA was used for qPCR using Luna universal one-step RT-qPCR kit (NEB) as per manufacture’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The Luna Universal One-Step RT-qPCR kit (E3005L) was used for qRT-PCR analysis following the protocol described by the supplier (NEB) by using a CFX96 real-time C1000 thermal cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...
-
bioRxiv - Immunology 2020Quote: ... the first one obtained by digesting the pcDNAI-GAL4-CREB vector with EcoRI and XbaI restriction enzymes (New England Biolabs), and the second part obtained by amplifying either the extracellular or the intracellular coding regions of the MerTK vector by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... RNA levels of target proteins were subsequently quantified by using RT-with the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermocycler using gene-specific primers ...
-
bioRxiv - Microbiology 2022Quote: The copy number of viral RNAs were titrated by qRT-PCR using Luna Universal Probe One-Step RT-qPCR Kit (NEB) and LightCycler 96 instrument (Roche) ...
-
bioRxiv - Genomics 2022Quote: Real-time PCR (RT-PCR) amplification of RNA was performed following the Luna Universal One-Step RT-qPCR kit (New England Biolabs). A CFX 96 Touch Real-Time PCR Thermocycler/ Detection System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 4°C for up to one month until used for purification of total RNA with the Monarch Total RNA Miniprep Kit (NEB). Five larvae were pooled for each RNA purification and homogenized in DNA/RNA protection buffer with a glass homogenizer prior to proteinase K digestion ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... The remaining 50 μL was used as input for one round of end repair and adapter ligation with NEBNext Ultra II DNA Library Preparation kit (NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... This plasmid was digested with XbaI and NheI enzymes to release TcZC3H12-HA sequence followed by the Neomycin expression cassette and treated with One Taq DNA polymerase (NEB) to allow for cloning in pCR2.1-TOPO plasmid (Invitrogen) ...