Labshake search
Citations for New England Biolabs :
3701 - 3750 of 4230 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and amplified with the primers (5’-CAA GAC TAG TGG AAG CGG AGC TAC TAA CTT CAG CCT GCT GAA GCA GGC TGG CGA CGT GGA GGA and 5’-NNN NAC GCG TCT AGC CTT CCC AGA CGT ACC C) using high-fidelity Phusion polymerase (NEB, Cat# M0530S). The PCR fragment was digested with BmtI and MluI ...
-
bioRxiv - Genetics 2023Quote: ... One microliter of T-tailed DNA adaptors diluted to 1.5 µM in water was added to 5 µl of amplicons diluted to 1/10 in water and 5 µl of 2X Blunt/TA Ligase Master Mix (New England Biolabs, Herts, UK) and incubated 30 min at 25°C for ligation ...
-
bioRxiv - Microbiology 2024Quote: ... 39 μl of each benzonase-treated lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1 μl (400 units ...
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting fragment was subjected to error-prone PCR under the following conditions: 5 U of Taq DNA polymerase (New England Biolabs, MA, USA), 200 μM of each deoxynucleoside triphosphate ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... before being incubated in 5% normal goat serum dissolved in PBS-TX (NGS-PBS-TX; NGS; New England BioLabs, Hitchin, Hertfordshire, UK) for a minimum of one hour at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: In vitro transcribed RNAs were treated with Antarctic phosphatase (Fermentas, Waltham, MA) to remove the 5’ terminal phosphate and then labeled by T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA) in the presence of γ-32P-labeled ATP (PerkinElmer ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was A-tailed with Fermentas Klenow 3′ to 5′ exonuclease (Cat# EP0421) and ligated with adaptor oligonucleotides (NEB NEXT adaptor oligos) using Mighty Mix Ligase (Cat# TAK6023) ...
-
bioRxiv - Bioengineering 2022Quote: Reunion of 4-6 nM of dsDNA template (gblocks® Gene Fragment, IDT) to a solution of 5 U/μL of T7 RNA polymerase (NEB, M0251), 200 nM Cas9 (S ...
-
bioRxiv - Biochemistry 2022Quote: ... and the impurities that were tagged by Chitin Binding Domain were extracted on a gravity-flow column using 5 mL Chitin resin (New England BioLabs, Evry, France). The target proteins were purified with HisTrap HP columns (GE Life Sciences ...
-
bioRxiv - Genomics 2022Quote: ... we amplified a 150 bp sequence using primers pGL3-CDC20_F and pGL3-CDC20_R (Phusion High-Fidelity PCR Master Mix, NEB M0531, Supplemental Table 5) that added restriction sites for SacI and XhoI to the 150 bp sequence ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... a 5’ phosphorylated 3’ end adapter featuring 4 randomized nucleotides at the 5’ terminus and a 3’ blocking group (3C Spacer; 3SpC3, IDT) underwent adenylation using Mth RNA ligase (New England Biolabs, cat# M2611A). Adapters were subsequently ligated to deacylated and demethylated RNA templates using a truncated KQ T4 RNA ligase 2 (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... primers (forward primer 5’gcacccgggATGAGTGATACTAAAGAGACTGTTCC3’ and reverse primer 5’gacctcgagTTAACAACATCCTCCTTTCTTTT3’) were used in PCR amplification using Phusion® High-Fidelity PCR master mix (M0531S, New England Biolabs, USA). The amplified products were electrophoresed on 1% (w/v ...
-
bioRxiv - Synthetic Biology 2024Quote: ... approximately 1 µg of plasmid DNA was added to a digestion mixture containing 5 µL of rCutSmart Buffer (New England Biolabs, Cat# B6004S), 10-20 units of each restriction enzyme ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg (final volume 100 μL) of the resulting mRNA was incubated with and without RNA 5’-pyrophosphohydrolase (RppH; NEB, 50 U) at 37° C for 1 hour in the supplied 1X buffer (72) ...
-
bioRxiv - Microbiology 2024Quote: ... Decapping of the 5’ DTB-GTP cap was performed to leave the 5’ monophosphate for ligation by adding 20 μl of capped RNA to 2.2 μl of 10X ThermoPol buffer (NEB product number B9004) and 2 μl RppH (NEB product number M0356S) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The amplicons were purified and subjected to error-prone PCR under the following conditions: 5 U Taq DNA polymerase (New England Biolabs, MA, USA), 200 μM of each deoxynucleoside triphosphate ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The pR and pM probe pools were assembled at a 1:5 vector-to-insert molar ratio using T4 ligase (New England Biolabs, Cat# M0202L) and BbsI-HF (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were incubated at 37°C and stopped for indicated time periods and the reaction was stopped by addition of 2 × RNA loading dye (New England Biolabs). For electrophoresis ...
-
bioRxiv - Genetics 2021Quote: ... input genomic DNA was amplified in a 20 μL reaction for 25 cycles using NEBNext High-Fidelity 2× PCR Master Mix (NEB). PCR products were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Microbiology 2020Quote: ... This gBlocks fragment and a NdeI-HindIII-digested pET21b backbone were assembled together using a 2× Gibson master mix (NEB). Gibson assembly was possible due to a 23-bp sequence shared between the NdeI-HindIII-cut pET21b backbone and the gBlocks fragment ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA (2 μL) was used as template in 50 μL PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Genomics 2020Quote: ... Beads containing the ssDNA extension products were suspended in 10 μl of polyadenylation master mix containing 2 units of terminal transferase TdT (New England Biolabs), 1x TdT buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAse I digestion to analyse 2’-O-ribose methylation was done in the presence of 10 U T4 PNK (NEB) in 50 mM Tris-acetate (pH 6.5) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Labelling of total histones was performed by a 30 min-pulse with 2 µM of the SNAP-cell SiR-647 reagent (New England Biolabs) followed by 30 min wash in fresh medium.
-
bioRxiv - Molecular Biology 2020Quote: ... then blunted overnight at 37°C in 100 μl NEBuffer 2 with 0.1 mM dNTPs and 1 μl Klenow (NEB M0210S). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SNAP-tagged histones neosynthesized during the chase time were pulse-labeled by incubating cells with 2 μM of red-fluorescent SNAP reagent (SNAPcell TMR star, New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... after incubating the samples with 2 μl of RNase A (Thermo) at 37 °C for 2h and then with 8 μl of proteinase K (NEB) at 55 °C for 4h ...
-
bioRxiv - Molecular Biology 2021Quote: A CD22 cDNA fragment encoding the first two Ig-like domains fused to an EK-hIgG-Fc fragment was amplified by PCR and cloned into the mammalian expression vector pACP-tag(m)-2 (New England Biolabs).
-
bioRxiv - Genomics 2020Quote: ... The gRNA was ordered as a single stranded oligo gblock from IDT and amplified using 2 50 uL reactions of Q5 High Fidelity 2X Master Mix (NEB). Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138 ...
-
bioRxiv - Genomics 2020Quote: Synthetic SARS-CoV-2 RNA templates were serially diluted and amplified by RT-LAMP using the WarmStart LAMP Kit (NEB). LAMP primers were added to a final concentration of 0.2µM for F3 and B3 ...
-
bioRxiv - Molecular Biology 2021Quote: Plasmid mutagenesis to create SARS-CoV-2 mutant genes was achieved using the Q5® Site-Directed Mutagenesis (SDM) Kit according to the manufacturer’s instructions (NEB) or by using Gibson assembly with mutations introduced into the complementary overhang regions of the primer sequences ...
-
bioRxiv - Biochemistry 2020Quote: ... small RNA library preparation was performed using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2) (NEB). cDNA libraries were sequenced on a HiSeq2000 platform in a spike-in format in paired-end 50 (PE50 ...
-
bioRxiv - Microbiology 2020Quote: Reverse transcription and amplification for figure 2 was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S). Both the OneTaq One-Step RT-PCR Kit and Luna Universal One-step RT-qPCR Kit (cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... Custom oligos flanking the targeted sites were used to amplify genomic DNA from pooled edited cells (Supplementary Table 7) using High-Fidelity 2× Master Mix (New England Biolabs). Indel frequencies were quantified by comparing unedited control and knockout cell lines using Inference of CRISPR Edits (ICE)73.
-
bioRxiv - Developmental Biology 2020Quote: DNA was extracted from embryonic membranes or tail tissue using the HotShot method for 15 minutes (Truett et al., 2000) and 2 µl DNA was used for PCR with Phusion polymerase (New England Biolabs). For Geminin and Cre PCRs ...
-
bioRxiv - Biochemistry 2020Quote: ... the nonstop GFP1-10 sequence was produced by PCR using primers #1 and 2 and Q5 High-Fidelity DNA Polymerase (NEB) with pETGFP 1-10 vector as a template (Cabantous et al. ...
-
bioRxiv - Genetics 2021Quote: Amplified DNA was digested at 37 L for 2 h with the restriction enzyme StyI-HF (NEB, Ipswich, MA, USA) and products were run on a 0.8 % agarose gel stained with Invitrogen™ SYBR™ Safe DNA Gel Stain (Life Technologies ...
-
bioRxiv - Genomics 2020Quote: ... and then RT was conducted to generate first-strand cDNA using the following protocol: 2 μl of 10 mM dNTPs (New England Biolabs), 5× first-strand buffer ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μg of genomic DNA was fragmented in a 20-μl reaction consisting of 2 μl of 10X fragmentase buffer (New England Biolabs) and 2 μl fragmentase (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: 20 μg of SARS-CoV-2 Spike trimer was deglycosylated by incubating with 2.5 μL of PNGase F (NEB, SG) under native condition at 37 °C for 4 h ...
-
bioRxiv - Bioengineering 2021Quote: ... recognition sequence was inserted into a non-coding region of the pETh oncocin plasmid to enable nicking mutagenesis (Supplementary Table 2).43 The pETh oncocin plasmid was digested with SphI (NEB), and the BbvCI recognition sequence was inserted via NEBuilder® HiFi DNA Assembly (NEB).