Labshake search
Citations for New England Biolabs :
3551 - 3600 of 6510 citations for 6 Chloro 2 4 chlorophenyl N N dimethylimidazo 1 2 α pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... We then amplified barcodes from both cDNA and DNA in 4 PCR reactions per sample using Q5 (NEB #M0492) and primers specific to the reporter genes (GWLP P3 ...
-
bioRxiv - Genetics 2023Quote: ... digested pJFRC12-10XUAS-IVS-myr::GFP backbone using the following reactions conditions: 4 µL T4 ligase buffer (10x) (NEB), 20 µl plasmid backbone DNA (0.005 pmol) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNAs were eluted by mixing the beads with 21µl RNase H Elution Buffer and 4 µl RNase H (New England Biolabs) and incubated at 37 °C for 30 min while shaking ...
-
bioRxiv - Microbiology 2023Quote: ... Reactions were set up as per manufacturer’s instructions with the addition of 4 units of Murine RNase Inhibitor (NEB) and 5% DMSO ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 unit µL-1 EcoRI-HF (New England Biolabs)) ...
-
bioRxiv - Biophysics 2020Quote: ... 1 U μL−1 murine RNase inhibitor (NEB, M0314L), 600 ng mRNA and 50 μM PF846 in 1% DMSO ...
-
bioRxiv - Genomics 2021Quote: ... 1 unit/μl RNA ligase 1 (New England Biolabs), 1× RNA ligase buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 U.μL-1 of murine RNase Inhibitor (NEB M0314), 500 μM of rNTPs (NEB ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 U.μL-1 of murine RNase Inhibitor (NEB M0314), 500 μM of rNTPs (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl 40 U/μl−1 RNase Inhibitor (NEB), and 1 μl T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1 U μl−1 RNase inhibitor (NEB), or bulk sorted into buffer RLT Plus (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1 μl T4 DNA Polymerase (1 U, NEB). Gap-filling reactions purified using the Zymo Research kit and eluted with 6 uL water ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µl of ExoI and 1 µl rSAP (NEB) were added to the recovery products and incubated for 15 min at 37°C followed by heat inactivation of 20 min at 80°C ...
-
bioRxiv - Microbiology 2024Quote: ... and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB) and T4 ligase (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... ChIP-seq libraries were prepared from 3-5ng ChIPed DNA using NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 3’ 3x FLAG tag was then inserted by site directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and the primers PPARGC1A_FLAG_SDM_F and PPARGC1A_FLAG_SDM_R (see Supplementary Table 1) ...
-
bioRxiv - Systems Biology 2022Quote: The small RNA sequencing libraries were constructed using 3 μg total RNA per sample and NEB Next® Multiplex Small RNA Library Prep Set for Illumina® (NEB) following the manufacturer’s recommendation ...
-
bioRxiv - Genomics 2022Quote: ... to 5 μg of input DNA (in total volume of 24 μl at >210 ng/μl) with 3 μl 10X CutSmart Buffer (NEB, Cat #B7204), and incubating for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then enriched via PCR amplification in a total volume of 50 μL containing 3 μL of NEB Next USER Enzyme (NEB, Ipswich, USA), 25 μL of NEB Next High-Fidelity PCR Master Mix (2× ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... 3 µg of dam-dcm- plasmid DNA in a 50 µl reaction containing 20 U of M.SssI methylase (NEB, Ipswich MA, USA), 1X NEBuffer 2 ...
-
bioRxiv - Genetics 2021Quote: ... DNA fragments with A-3’ end overhangs were then ligated to the DS adaptors with T-3’ overhangs using the NEBNext® Ultra™ II Ligation Module (New England Biolabs) following the manufacturer’s instructions and then purified by 0.8 volumes of AMPure XP beads (Beckman Coulter).
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...
-
bioRxiv - Microbiology 2020Quote: ... 1-3 μg RNA was used to generate sequencing libraries with NEBNext Ultra™ RNA Library Prep Kit for Illumina (#E7530L, NEB, USA) with poly(A ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... The solution was transferred to 42°C for 15 min and incubated overnight in 3 U of β-agarase I (New England Biolabs, M0392). Next ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... and reverse primer (5’-AAG ATT CTC GAG ATG GTG ATG GTG ATG G-3’) were combined using the Q5 site-directed mutagenesis protocol (New England Biolabs, Ipswitch, MA). The resulting plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Microbiology 2020Quote: ... The BAC containing viral cDNA was cleaved at a unique restriction site located downstream of the 3’-end poly(A) tail using NotI-HF (Ref. R3189S, NEB, Grenoble, France). In parallel ...
-
bioRxiv - Microbiology 2021Quote: ... HA tag sequences were added to the 3’ end of the hACE2 transgenic cDNA using a Q5® Site-Directed Mutagenesis Kit (NEB#E0554S) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... The gRNA target sequences GAAGAGGTGAACTGCCTTT (NIPBL exon 3) and CTCGTTCTGATTTTAACCG (NIPBL exon 10) were cloned into the gRNA empty vector using Phusion polymerase (M0530S: New England Biolabs, Ipswich, MA) and the Gibson assembly system (E5510S ...
-
bioRxiv - Cell Biology 2020Quote: The myo-3p::EFF-1 plasmid was constructed by cloning the myo-3 promoter region from myo-3p::mCherry plasmid with Sal I (New England BioLabs Cat#R3138) and Nhe I (ThermoFisher Cat# FD0974 ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...
-
bioRxiv - Genetics 2021Quote: Sequencing libraries were prepared from either 500 ng total RNA or 3 µl TraPR-enriched [80] sRNA with the NEBNext Multiplex Small RNA Library Prep Set for Illumina (E7300; NEB, Ipswich, Massachusetts) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared for sequencing by Cambridge Genomics Services using 3 μg of total RNA and an Ultra™ RNA library prep kit for Illumina (NEB, USA). Libraries were quantified by PCR ...
-
bioRxiv - Genomics 2020Quote: ... and once the solution is clear 48 uL of the elution was transferred to a 2mL Lo-Bind tube with End-Repair and A-tail buffer (7 uL) and enzymes (3 uL) premixed (NEBNext® Ultra™ II kit, New England Biolabs). The solution was then mixed by gentle tapping and transferred to a 0.2 mL PCR tube and incubated at 20 degrees C for 30 minutes and 65 degrees C for 30 minutes in a thermocycler ...
-
bioRxiv - Genetics 2019Quote: ... EcoRV-digested amplicons encoding gRNA pairs were inserted into the vector in 3 separate Gibson assembly reactions (NEB Gibson Assembly Master Mix) according to manufacturer’s specifications ...
-
bioRxiv - Genomics 2021Quote: ... 3 ng of DNA was used for library preparation according to NEBNext® Ultra™ II DNA Library Prep Kit (NEB, E7645S). Purity and size distribution was analyzed on Fragment Analyzer ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... RNAs (either from ribosome footprints or fragmented RNAs from total cytoplasmic RNAs) were dephosphorylated at their 3’ end using PNK (New England Biolabs, Cat: M0201) in the following buffer ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were then run on a 3% agarose gel and the product was extracted using NEB Monarch DNA Gel Extraction Kit (NEB, Cat# T1020L). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 3 µg of DNA from each sample was digested with two restriction enzymes (PstI; NEB catalog #R0140 and XhoI; NEB catalog #R0146). The digested genomic DNA was resolved on a 1% ...
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...