Labshake search
Citations for New England Biolabs :
301 - 350 of 1855 citations for Recombinant Mouse Regenerating Islet derived 3 Alpha His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was incubated at room temperature for 10 min followed by transformation into 5-alpha competent cells (NEB). The E ...
-
bioRxiv - Microbiology 2020Quote: ... 2μL of the resulting mix was transformed into chemically competent Escherichia coli (High efficiency DH5-alpha, New England Biolabs) according to manufacturer’s instructions and cultured for 16 hours on Luria broth (LB ...
-
bioRxiv - Microbiology 2021Quote: ... and npmA F and npmA_R, respectively (Table S5) Assembled vectors (Figs. S4C, S4D) were transformed into NEB 5-alpha (New England Biolabs), selecting for ampicillin and gentamicin resistance ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Each library was split in two and transformed separately into 5-alpha cells (NEB, 3.5uL DNA in 35uL cells). Plasmid library isolation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cloning was performed with the NEBuilder Hi Fi DNA Assembly kit (New England Biolabs). The enzymes mentioned were purchased from New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: In situ Hi-C experiments were performed as previously described2 using restriction enzyme MboI (NEB) with minor modifications ...
-
bioRxiv - Genomics 2023Quote: ... pooled oligonucleotides were amplified via PCR using NEBNext 2X Hi-Fi PCR Master Mix (NEB) and primers:
-
bioRxiv - Microbiology 2023Quote: ... His/Strep-Tag was cleaved using enterokinase according to the protocol of the manufacturer (NEB) and GlnA3Mtwas immediately purified from the digestion mix by size-exclusion chromatography as directed by the resin manufacturer (GE-Healthcare).
-
bioRxiv - Cancer Biology 2024Quote: ... Hi-C libraries were treated with T4 DNA Polymerase (New England Biolabs, catalog No. M0203) to remove biotin from unligated ends ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Biophysics 2020Quote: mNG-tagged ADRβ2 and EGFR were generating by cloning into the pSNAPf-ADRβ2 backbone (New England Biolabs). mNG was amplified by PCR from mNG-C1 and placed between the EcoRI and SbfI sites of pSNAPf-ADRβ2 (replacing the SNAP tag ...
-
bioRxiv - Genomics 2021Quote: ... specified amounts of MCF7 genomic DNA or plasma-derived cfDNA were digested with LpnPI (New England Biolabs, Ipswich, MA) yielding 32 bp fragments around the fully methylated recognition site containing a CpG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two separate 8-µl aliquots of beads derived from each strain were treated with 1 µl lambda phosphatase (NEB) in 10 µl reactions containing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Rap1 arrays initially cloned in a pUC19-derived vector (Table S2) were digested with PvuII (New England Biolabs) and subsequently gel isolated ...
-
bioRxiv - Cancer Biology 2023Quote: Kinase-dead mutant (K37R) of Nek2A was derived from Nek2A in pJP1563 using Q5 Site-Directed Mutagenesis Kit (NEB) following the instructions of manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant MBP-Megator fragments were purified with amylose magnetic beads (New England Biolabs) and eluted in Column Buffer supplemented with 10mM Maltose ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15μL of myc-eIF6-bound beads were incubated with/without recombinant GSK3β (NEB) and suspended in cold kinase buffer and incubated at 30°C for 30 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM CaCl2) at room temperature in the presence of recombinant enteropeptidase (NEB) at 13 U enzyme per mg TMPRSS2 zymogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant protein was sequentially purified using an amylose column (New England Biolabs) followed by a nickel-nitrilotriacetic acid column (Qiagen ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Genomics 2024Quote: ... 200 µg/mL molecular biology grade recombinant albumin (rAlbumin) (New England Biolabs B9200S), 0.8 U/µL RiboLock RNase inhibitor (Thermo Fisher Scientific EO0384) ...
-
bioRxiv - Genomics 2021Quote: ... The reactions were combined and 2.5 μL of the assembly reaction or a control reaction without amplicon were used to transform NEB5-alpha cells (New England Biolabs) to measure background assembly ...
-
bioRxiv - Biochemistry 2022Quote: ... The following cloning strains were used: NEB Stable (lentiviral and piggybac vectors) and NEB 5-alpha (all other plasmids) (New England Biolabs). For cloning of base editor constructs ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids carrying the dcas9/lacI cassette were recovered and propagated in the NEB 5-alpha F’ Iq strain (New England Biolabs). Cloning and/or propagation of plasmids containing the dcas9/lacI cassette in host E ...
-
bioRxiv - Molecular Biology 2022Quote: ... following the manufacture’s protocol. Plasmids were transformed in DH5-alpha or DH10-beta chemo-competent Escherichia coli (E. coli) cells (New England Biolabs). Transformed bacteria were grown in LB medium supplemented with 50 μg/mL kanamycin or 100 μg/mL carbenicillin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The tagged pore variant plasmids were constructed by Gibson assembly using NEBuilder HiFi DNA Assembly Master Mix (NEB), where the variant encapsulin genes were individually amplified by PCR from the untagged pore variant plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... FLAG-tagged GPI-anchored PROM1- EX1 was generated by the DNA assembly method (#E2621, NEB, Ipswich, MA, USA). The GPI- anchor signal sequence from pCAG:GPI-GFP (#32601 ...
-
bioRxiv - Cell Biology 2020Quote: ... The Myc-tagged Nix-S212A and Nix-S212D were generated using a Q5 mutagenesis kit (New England Biolabs). The lentiviral shNix (Addgene #100770 ...
-
bioRxiv - Cell Biology 2023Quote: ... Snap-tagged human β1AR and β2AR constructs were labeled with Snap-cell 647 SiR (New England Biolabs, S9102S) at 1:1000 concentration for 20 min at 37°C in DMEM without phenol red supplemented with 30 mM HEPES ...
-
bioRxiv - Genomics 2023Quote: ... The end-tagged DNA was oxidized in 15 μL BGT reaction mix (0.3 μL Uridine Diphosphate Glucose (NEB), 1.5 μL NEBuffer 4 (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... In-vitro-transcription was carried out using the Hi-Scribe RNA transcription kit (New England BioLabs). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrations measured using Qubit 1X dsDNA HS Assay) was treated with 5U of RNAse HI (NEB) in RNAse HI buffer for 30 min at 37°C and then nucleic acids were purified with GeneJET Gel Extraction and DNA cleanup micro kit (General cleanup protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ENTR and DEST vectors were generated using Gibson assembly (NEB Builder Hi-Fi DNA assembly #E2621S) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μg of His-PKR was dephosphorylated using 3,200 units of λ-PPase (New England Biolabs) in 200 μl reaction buffer (50 mM HEPES ...
-
bioRxiv - Plant Biology 2022Quote: ... The HIS tag was removed from the mature sequence of AgLTP24 with enterokinase (NEB, Evry, France) for 16 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids for the trans-Tango components were generated using the Hi-Fi DNA Assembly (NEB #E5520S), BP Gateway Cloning (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Hi-C single-index library preparation was performed as previously described56 using MboI (New England Biolabs) restriction enzyme.
-
bioRxiv - Microbiology 2023Quote: ... 750-basepair regions flanking each gene were amplified by PCR and Hi-Fi DNA Assembly (NEB) was used to clone into pExchange-tdk ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Microbiology 2024Quote: ... Tags (6x His or HA) were introduced using site-directed mutagenesis with KLD enzyme mix (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.