Labshake search
Citations for New England Biolabs :
301 - 350 of 10000+ citations for Rat Heat Shock Protein Beta 2 HSPB2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... and extracted nuclear proteins were treated with lambda protein phosphatase (NEB) according to the manufacturer’s instruction.
-
bioRxiv - Genomics 2020Quote: ... Endogenous proteins were captured onto protein G-magnetic beads (NEB; #S1430S), washed extensively in IP buffer and used for POT1wtand POT1V29L source ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The Python script by default selects codons with the highest usage frequency for the input organism (E. coli NEB 10-Beta in this study), unless specified problematic sequences are introduced (Supplementary Figure S3B) ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used 50 μL Protein A or Protein G Magnetic beads (NEB) and washed twice with PBS with 5 mg/ml BSA and 4 μg of antibody coupled in 500 μl PBS with 5 mg/ml BSA overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: All constructs encoding for the protein fragments that were used as the tagless analyte in SPR experiments were produced using the IMPACT protein purification kit (NEB) following the manufacturer’s guidelines for cloning and refolding from denaturing conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... K4A with K3WA) mutants of the full-length RAD51AP1 protein were generated by Q5 Site-Directed Mutagenesis kit (New England Biolabs) following the instructions of the manufacturer and the primer pairs listed in Table 1.
-
bioRxiv - Microbiology 2021Quote: ... cholerae H-NS protein was purified as previously described (4) using the IMPACT-kit (New England Biolabs, Catalogue No. #E6901S). Briefly ...
-
bioRxiv - Biochemistry 2022Quote: In vitro protein translation was carried out (in absence of the release factors) using the PURExpress ΔRF123 kit (New England Biolabs). This guaranteed the stabilization of the ternary complexes mRNA-affitin-Ribosome ...
-
bioRxiv - Microbiology 2021Quote: ... RNA levels of target proteins were subsequently quantified by using RT-with the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermocycler using gene-specific primers ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were carried out in 10 μl of the purified components from the PURExpress In Vitro Protein Synthesis Kit (E6800S/L, NEB) with the corresponding templates ...
-
bioRxiv - Microbiology 2021Quote: pTXB1 and pTYB21 derivatives for protein overproduction were constructed based on the guidelines provided with the IMPACT kit (New England Biolabs). The coding sequences of nepR1 ...
-
bioRxiv - Immunology 2022Quote: Protein expression plasmids were constructed using dsDNA gBlocks from IDT and NEBuilder® HiFi DNA Assembly Cloning Kit (NEB, E5520S) and then transformed in NEB 5-alpha competent cells (NEB ...
-
bioRxiv - Microbiology 2023Quote: Reporter fusions of sRNA targets were in-vitro translated in the absence and presence of sRNA using the PURExpressⓇ In Vitro Protein Synthesis kit (NEB). Four picomoles of in-vitro transcribed 5’UTR reporters (including the RBS/sRNA interaction site and the first 10 codons of flgM ...
-
bioRxiv - Plant Biology 2023Quote: ... A cDNA clone for the 2b protein of Ho-CMV was recapitulated by site-directed mutagenesis of the coding sequence of the Fny-CMV 2b protein using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The resultant DNA product encoding the recapitulated Ho-CMV 2b protein contained the amino acid substitutions S47A ...
-
bioRxiv - Genomics 2023Quote: Constructs encoding either a GFP or an RFP protein were PCR amplified and in-vitro transcribed from a T7 promoter with the HiScribe T7 Kit (NEB), using a mixture of ATP ...
-
bioRxiv - Biochemistry 2023Quote: ... four cycles of RD were performed using the PureExpress in vitro protein synthesis kit (New England Biolabs, Ipswich, MA, USA) for in vitro transcription and translation ...
-
bioRxiv - Molecular Biology 2023Quote: ... by replacing the green fluorescent protein (GFP) with a mCherry reporter using the NEBuilding HiFi DNA Assembly Cloning Kit (New England Biolabs) (Ran et al. ...
-
bioRxiv - Neuroscience 2023Quote: RNA was released from the beads through protein K lysis (Monarch® Total RNA Miniprep Kit; New England Biolabs, #T2010S). After lysis ...
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed in a final volume of 100 μl using the PURExpress ΔRibosome In vitro Protein Synthesis Kit (New England Biolabs) according to the manufacturer instructions and with ribosomes purified from E ...
-
bioRxiv - Biochemistry 2024Quote: In vitro translation was monitored by the production of luciferase signal in a PURExpress in vitro protein synthesis kit (NEB), using firefly luciferase mRNA as an input ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Lambda Protein Phosphatase (NEB) assay was performed as described by the supplier ...
-
bioRxiv - Biochemistry 2020Quote: ... Cas9 protein (NEB M0641S) and phenol red injection dye ...
-
bioRxiv - Developmental Biology 2021Quote: Cas9 protein (M0646, NEB) and sgRNAs against antisense of exons 14 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified using the Luna Universal Probe Onestep RT-qPCR kit (New England Biolabs) and US CDC real-time RT-PCR primer/probe sets for 2019-nCoV_N1 ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment (sense/anti-sense) Pceh-23_L::acy-2 fragment(sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at 37°C and purified using Monarch® DNA Gel Extraction Kit (T1020S, New England Biolabs) before digestion-ligation with the gRNA-pScaffold-H1 using FastDigest Esp3I and T7 Ligase (M0318L ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA libraries for Illumina sequencing were prepared with the NEBNext Ultra 2 DNA Library Kit for Illumina (NEB, E7645L) using 200ng of DNA and custom made unique dual indices (8bp) ...
-
bioRxiv - Microbiology 2023Quote: The pGEX-6P-PrkA1-338 plasmid (Table 2) was constructed by a two-part ligation (NEB Quick Ligation kit) of BamHI- and NotI-linearized pGEX-6P and PCR-generated prkA1-338 amplified with primers AS21 and AS81 (Table 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 (NEB #E7500) and 3 (NEB #E7710 ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: Purified LPR1 protein was analyzed using Protein Deglycosylation Mix II (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein (200 µg) was precleared with protein G magnetic beads (New England Biolabs) and incubated overnight (4° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleaved G protein was dephosphorylated by lambda protein phosphatase (NEB, Frankfurt, Germany), calf intestinal phosphatase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... The protein ladder used was Colour Protein Standard Broad Range (NEB, Ipswich, US).
-
bioRxiv - Biochemistry 2020Quote: In vitro trans-translation assays were performed using the PURExpress In Vitro Protein Synthesis and Δ Ribosome kits (New England Biolabs). For trans-translation assays ...
-
bioRxiv - Plant Biology 2020Quote: 20-33 kD subregions of NRPD1 and RDR2 polypeptides were expressed in vitro using a PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 Spike mutant D614G was generated by site-directed mutagenesis using as an input DNA the expression vector encoding SARS-CoV-2 Spike_614D protein (kindly provided by J. Garcia-Arriaza, CNB-CSIC) by Q5 Site Directed Mutagenesis Kit (New England Biolabs, Barcelona, Spain) following the manufacturer’s instructions ...