Labshake search
Citations for New England Biolabs :
301 - 350 of 698 citations for Phospholipase A and Acyltransferase 4 RARRES3 PLAAT4 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies used were: New England Biolabs (NEB), Hitchin ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse antibodies against MBP (NEB E8032L, 1:20,000) were used to detect 2XMBP-tagged proteins and rabbit antibodies against HA (Cell Signaling C29F4 ...
-
bioRxiv - Cancer Biology 2024Quote: The rabbit anti-m6A antibody (#E1610S, NEB, U.S.A) was conjugated to Protein A agarose beads (Sigma ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM UTP and 1 mM GTP and 4 mM ARCA (Anti-Reverse Cap Analog) (NEB)) ...
-
bioRxiv - Genetics 2024Quote: ... Plugs were then equilibrated in NEBuffer 4 and treated with 75 U of exonuclease T (NEB) for 90 min at 24 °C.
-
bioRxiv - Biochemistry 2024Quote: ... Alkaline phosphatase treatment was performed over night at 4°C using Lambda Protein Phosphatase (#P0753S, BioLabs).
-
bioRxiv - Genetics 2024Quote: ... 4) IDS-KO receiving 1 mg/kg idursulfase IV and nebulized idursulfase (KO-NEB, n = 5). The nebulized idursulfase was delivered as 167 µL of 2 mg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Neuroscience 2022Quote: ... and probed with p62 antibody (NEB D5L7G, 1:800) and streptavidin-594 (Biolegend 405240 ...
-
bioRxiv - Microbiology 2024Quote: ... and detected using anti-MBP antibodies (New England Biolabs). As a negative control ...
-
bioRxiv - Neuroscience 2023Quote: ... TCF/LEF family antibody sampler kit (New England BioLabs), NFAT1 (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2022Quote: Anti-M13-pIII monoclonal antibody (E8033S, New England Biolabs), sheep anti-mouse IgG (H/L):HRP (AAC10P ...
-
bioRxiv - Plant Biology 2023Quote: ... after which an anti-p42/p44-erk antibody (NEB) was employed to detect the activated MAPKs on western blots.
-
bioRxiv - Cell Biology 2023Quote: ... anti-SNAP-tag antibody (New England Biolabs, Ref. P9310S), anti-clathrin heavy chain antibody (BD Bioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using a pre-poured amylose column containing 4 mL amylose resin (New England Biolabs, E8021L) followed by size exclusion chromatography (protein buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA was first chemically fragmented (4 min) and then enzymatically treated with Antarctic Phosphatase (NEB#M0289S) and T4 Polynucleotide Kinase (NEB#M0201S) ...
-
bioRxiv - Immunology 2021Quote: ... 240 nM dT-primer* (Metabion, Planegg, Germany) and 4 U RNase Inhibitor (New England Biolabs, Frankfurt, Germany). Reverse transcription and addition of the template switch oligo was performed at 42 °C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Biochemistry 2020Quote: ... The second aliquot was incubated overnight at 37 °C with β1-4 galactosidase (New England Biolabs #P0745) using the same reaction conditions as the neuraminidase above ...
-
bioRxiv - Neuroscience 2022Quote: ... Gelated samples were digested in 4 U/ml proteinase K buffer (New England Biolabs, Ipswitch, MA, USA) with 50 mM Tris pH 8.0 (Serva ...
-
bioRxiv - Cell Biology 2022Quote: ... Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: ... was digested for 4 h at 37 °C using the restriction enzyme BbsI (#R3539S, New England Biolabs) and run on a 1 % agarose gel for 3.5 h at 100 V ...
-
bioRxiv - Developmental Biology 2021Quote: ... gently resuspended in fixation buffer (PBS, 0.1% saponin, 4% PFA, RNAsin [New England Biolabs #M0314] 1:20) and incubated for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... 4 μg of total RNA were reverse-transcribed by the M-MLV reverse transcriptase (New England BioLabs) following the manufacturer specifications and using oligo d(T ...