Labshake search
Citations for New England Biolabs :
301 - 350 of 1262 citations for Neuroligin 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... and 3 cycle barcoding PCR is performed (NEB, E7645S). 2×150bp paired end sequencing data is generated on Illumina HiSeq 4000 at Novogene.
-
bioRxiv - Genetics 2020Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Genomics 2021Quote: ... Then 3 μl of USER Enzyme buffer (NEB, USA) was incubated with size-selected ...
-
bioRxiv - Molecular Biology 2022Quote: ... An additional 3 µL of BamHI-HF (NEB R3136L) was added to linearize mtDNA from all cell lines with the exception of human skeletal muscle myoblasts ...
-
bioRxiv - Molecular Biology 2022Quote: ... for which 3 µL of EagI-HF (NEB R3505) was added due to the mitochondrial genome in this cell line having a SNP resulting in a second BamHI cut site ...
-
bioRxiv - Microbiology 2022Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... a custom 3’ adapter (5ʹ-rAppCTGTAGGCACCATCAAT–NH2-3ʹ, NEB) was ligated to all RNAs following the protocol described in (91) ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μl of 50% PEG 8,000 (New England Biolabs), 1 μl of iTP_3’_linker_ApoI (10 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...
-
bioRxiv - Genetics 2023Quote: CAAGCAGAAGACGGCATACGAGAT-3’) and Phusion DNA polymerase (New England Biolabs,
-
bioRxiv - Genomics 2023Quote: ... Each reaction contained 3 uL BbsI (New England Biolabs), 1.25 uL T4 ligase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... NU-1611-Cy3),1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was 3’ dephosphorylated using T4 Polynucleotide Kinase (NEB) and preadenylated linkers were ligated to the RNA fragments using T4 RNA Ligase 2 K277Q (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 µL 5ʹ Deadenylase (New England Biolabs, M0331S) at 37°C for 1 h and further cleaned up by using a Zymo RNA Clean and Concentrator-5 purification kit (Zymo Research ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 U BglII (New England Biolabs, Cat. No. R0144S) and 6 U SalI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5ul of Klenow Fragment (3’→5′ exo-, NEB, M0212S) and 1.5ul of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3000 ng of high molecular weight DNA was prepared by blocking available DNA ends with calf intestinal phosphatase (NEB Cat #M0525). DNA and dA-tails on all available DNA ends were cleaved by RNPs and Taq polymerase (New England Biosciences Cat #M0273 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Cell Biology 2024Quote: ... Thymidine was then removed by washing cells with culture media and blocking of existing CENP-A was performed by treatment with 10 mM SNAP-Cell® Block BTP (S9106S, NEB) for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... with TdTomato was amplified by PCR with primers (5’- ggcgcgCCCCCCTCTCCCTCCCCCCC -3’ and 5’- ggcgcgccTTACTTGTACAGCTCGTCCATGCCGTACAG -3’) using Hot start Q5® polymerase (NEB, Frankfurt, Germany) from LeGO-iT (a gift from Boris Fehse ...
-
bioRxiv - Cancer Biology 2020Quote: ... A 3’ A overhang was added to the ends of the blunted DNA fragment with Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments was then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... We first joined sequences for fluorescent protein mCerulean (CFP) and 2A peptide P2A (a ribosomal skip sequence) with Q5 (NEB) fusion PCR and added them to the pWPXL vector with Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Bioengineering 2020Quote: ... Respective peptide DNA coding sequences (CDS) were amplified from hACE2 via PCR and inserted using HiFi DNA Assembly Master Mix (NEB) for Gibson Assembly into the pcDNA3-SARS-CoV-2-S-RBD-Fc backbone linearized by digestion with NheI and BamHI ...
-
bioRxiv - Biochemistry 2022Quote: ... the sequence for the 50-residue hinge-region “C-peptide” (Ala317-Phe366) was removed via site directed mutagenesis (New England Biolabs). The construct further included the miniGs399 protein15 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3-FLAG-PKCα constructs expressing FLAG-tagged PKCα were generated by amplifying the coding region of PKCα from HeLa Tet-off cell total RNA and inserting it into pcDNA3-FLAG (45) immediately downstream of the FLAG peptide sequence using Gibson Assembly (NEB). Constitutive active PKCα-AE was generated by mutating alanine 25 into glutamic acid ...
-
bioRxiv - Developmental Biology 2022Quote: ... and zebrafish cachd1 ectodomain production constructs (ectodomain fused to hexahistidine and BirA ligase peptide substrate tags) were prepared by NotI/AscI restriction enzyme double digest (New England Biolabs) of pTT3-based vector backbones (50 ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Plant Biology 2022Quote: ... a YFP sequence was inserted just after putative endoplasmic reticulum signal peptide sequences in LTPG1 and LTPG2 using the homologous recombination Gibson Assembly system (New England Biolabs), according to Kim et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... Coding sequences for mouse Gata4 and E2-Crimson preceded by an E2A self-cleaving peptide (E2A-E2-Crimson) were assembled using NEBuilder HiFi DNA assembly (NEB) to generate pCX-Gata4-E2A-E2-Crimson ...
-
bioRxiv - Cancer Biology 2023Quote: 20 μL of the lysate DNA containing the peptide library was PCR amplified with Q5 high-fidelity DNA polymerase (New England Biolabs), for 15 cycles in a 50 μL reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3’ deoxy-adenine overhangs were added using Klenow Fragment (NEB), the sample was purified with QIAquick column ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions contained 3 µL of BSA (New England Biosciences (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μl AnP stock (5,000 units/ml, New England Biolabs) was added to 50 μM purified CST in Buffer A along with 0.5 mM ZnCl2 and 1mM MgCl2 ...
-
bioRxiv - Genomics 2021Quote: ... Adenylation was performed with 3’-5’ Klenow Fragment (NEB M0212L). Adaptors were ligated with NEB Quick Ligase for 10 minutes at 30°C before two rounds of cleanup with homemade beads ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Klenow fragment (3′ → 5′ exo−) (New England Biolabs). Hybridization was performed at 65°C overnight in the pre-hybridization solution containing 6x saline-sodium citrate buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... NEB Buffer 3 was replaced by T4 PNK buffer (NEB) in kinase assays in the presence or absence of Xrn1 (Figs 3a and 5d) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 15 units of Klenow Fragment (3’→5’ exo-, NEB). Following extension reactions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit) were added and incubated for 18 h at 16°C over-night ...
-
bioRxiv - Biochemistry 2022Quote: ... A-tailing (Klenow fragment (3’-5’ exo–, New England Biolabs), ligation to barcoded adapters (KAPA) ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.17 μL of random primers (3 mg/mL NEB) in a total volume of 5.25 μL ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’-CTTTTGACATCCGCTTCTGC-3’ followed by a T7 endonuclease assay (NEB) to detect indels ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by A-tailing (Klenow 3’-> 5’ exo-, NEB, M0212S). After A-tailing ...
-
bioRxiv - Bioengineering 2019Quote: ... and 3’-A-tailed with NEBNext dA-Tailing Module (NEB) following the recommendations of the manufacturer ...