Labshake search
Citations for New England Biolabs :
301 - 350 of 10000+ citations for Mouse UDP glucuronosyltransferase 1 2 UGT1A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.01 pmol (2:1 molar ratio of insert:backbone) library and 2.5 uL NEBuilder HiFi DNA Assembly Master Mix (NEB E2621) and incubated at 50 °C for 60 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using phenol-chloroform and subjected to ribosomal RNA removal using a NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB, Ipswich, MA). A RNAseq library was prepared by using a NEBNext® Ultra directional RNA library prep kit (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Immunology 2021Quote: ... Samples were added to second-strand synthesis mix containing 2× NEB buffer 2 (NEB), 625 nM dNTP Mixture (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 50 ng PCR product was incubated with 2 µL 10X NEBuffer 2 (NEB, B7002S) and nuclease-free water adding up to 19 µL using the following program ...
-
bioRxiv - Biochemistry 2019Quote: 2 μg of nucleosomes were incubated with 2 Kunitz units of Micrococcal nuclease (NEB) in buffer containing 10 mM Tris HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: Libraries were prepared from 1 ug RNA using a library prep kit (NEB #7770), rRNA depletion kit (NEB #E6310) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μg RNA was reverse transcribed to cDNA using LunaScript RT SuperMix Kit (NEB). qPCR was performed in 20 μl reactions containing diluted cDNA ...
-
bioRxiv - Genetics 2024Quote: ... immunoprecipitated RNA and 1% input RNA Monarch RNA Cleanup Kit (New England Biolabs, T2047L) was used according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 30 min at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... α2-3,6,8,9 neuraminidase A (NEB), LB Broth (BD Difco™) ...
-
bioRxiv - Microbiology 2020Quote: ... 2) NEB Q5 (NEB M0491), 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... T4 RNA ligase 2 (NEB) and RiboLock RNase inhibitor (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL DpnI (NEB # R0176L) is then added and the reaction incubated 1h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 units DNase I (NEB) or both for 1 hour at 37°C and resolved on a denaturing urea polyacrylamide gel (15% ...
-
bioRxiv - Immunology 2020Quote: ... 2 U DNase I (NEB) was added to IVT mixture and further incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 1 h at 37°C and resolved on a denaturing urea polyacrylamide gel (20% ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL DpnI (NEB # R0176L) is then added and the reaction incubated 30 min at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 U UDG (NEB, M0280S), and 1X UDG buffer (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... in 1x NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL ATP (NEB, B0202S), 2 μL 10X restriction digest buffer (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and set 2 (NEB #7500S) according to the manufacturer’s protocol with minor modifications as noted below ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Set 2 (E7500S, NEB). Quality of the final library preparation was analysed on the Bioanalyzer using the High Sensitivity DNA reagents kit and cassettes (5067-4626 ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM ATP) (NEB) at 30 °C for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... with 2 mM MgCl2 (NEB), 0.2mM dNTPs (made in house) ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of BSA (NEB), 15 μl of dNTPs 10 mM ...
-
bioRxiv - Molecular Biology 2021Quote: Variants of concern (VOC) of SARS-CoV-2 were created with Q5® Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA) according to manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Genomics 2023Quote: LIDAR and 3’-LIDAR libraries were analyzed on a 2% agarose gel and quantified using NEBNext Library Quant Kit for Illumina (New England Biolabs, Cat. No E7630L). Libraries were sequenced on an Illumina NextSeq500.
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Molecular Biology 2020Quote: ... then blunted overnight at 37°C in 100 μl NEBuffer 2 with 0.1 mM dNTPs and 1 μl Klenow (NEB M0210S). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Genomics 2019Quote: ... Bead-nuclei were pelleted for 2 min at 2500 g and resuspended in 189 µL blunting solution (1× T4 DNA ligase buffer (NEB), 0.25 mM dNTPs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 µl of the insert was treated with 2 µl Dpn1 enzyme in the presence of 1 µl Cutsmart buffer (10×) (New England BioLabs) for 2 h at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Biochemistry 2020Quote: ... the nonstop GFP1-10 sequence was produced by PCR using primers #1 and 2 and Q5 High-Fidelity DNA Polymerase (NEB) with pETGFP 1-10 vector as a template (Cabantous et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Plant Biology 2020Quote: ... 17 μl of the PCR reaction were mixed with 2 μl of CutSmart Buffer and 1 μl of AvaI (NEB) for a final volume of 20 μl ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Synthetic Biology 2022Quote: ... αlvus tRNAPyl (Ma-tRNAPyl)35 was prepared by annealing and extending the ssDNA oligonucleotides Ma-PylT-F and Ma-PylT-R (2 mM, Supplementary Table 1) using OneTaq 2x Master Mix (NEB). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch™) ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2022Quote: ... To seventeen microliters of the eluates were added 2 μL of 10x Nucleoside Digestion Mix reaction buffer and 1 μL of Nucleoside Digestion Mix (New England Biolabs). Reactions were incubated at 37 °C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... The agarose was digested by 1 hour incubation at 42 °C with 2 units of beta-agarase (M0392, New England Biolabs). After this stage ...
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was removed using a magnetic separator and washed once with 1 mL NEBuffer 2 and resuspended in 115 mL of Ligation reaction with Quick Ligase buffer (NEB), 6,000 U of Quick Ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: pTXB1 Halo 3C SARS-CoV-2 (2019-nCoV) Nsp1 1-179-Intein CBD (DU67780 was made using NEBuilder (New England Biolabs), amplifying the vector from existing clone DU28033 (pTXB1-HALO-Mxe Intein-CBD ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB) and amplified 9-13 cycles (depending on initial material amount ...