Labshake search
Citations for New England Biolabs :
301 - 350 of 2843 citations for Glyphosate Chemical Purity 96% 2 13C 99%; 15N 98%+ 1000 Ug Ml In Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL DpnI (NEB # R0176L) is then added and the reaction incubated 30 min at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 U UDG (NEB, M0280S), and 1X UDG buffer (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... in 1× NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... in 1x NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL ATP (NEB, B0202S), 2 μL 10X restriction digest buffer (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Set 2 (E7500S, NEB). Quality of the final library preparation was analysed on the Bioanalyzer using the High Sensitivity DNA reagents kit and cassettes (5067-4626 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and set 2 (NEB #7500S) according to the manufacturer’s protocol with minor modifications as noted below ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM ATP) (NEB) at 30 °C for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... with 2 mM MgCl2 (NEB), 0.2mM dNTPs (made in house) ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of BSA (NEB), 15 μl of dNTPs 10 mM ...
-
bioRxiv - Biochemistry 2020Quote: ... and RNAse free water and lastly 1.5 μL of T7 RNA polymerase (HiScribe T7 In Vitro Transcription Kit from New England Biolabs or AmpliScribe T7 High Yield Transcription Kit from Epicenter) ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were dialyzed with water on silica membranes (0.025 μm pores) for 1 hour before transformed into DH10β cells (New England Biolabs). Library sizes of at least 100,000 colony-forming units (CFU ...
-
bioRxiv - Cell Biology 2020Quote: ... samples in SDS containing sample buffer have been diluted with water to contain 0.5 % SDS and have been digested with Endo H (NEB) according to instructions by the manufacturer ...
-
bioRxiv - Zoology 2020Quote: ... The RNA pellet was resuspended with 30 µl of DNase/RNase free water and digested with DNase I (NEB) following the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... SmaI de-staining buffer (de-ionized water containing 1X cut smart buffer and 200 units of SmaI (NEB, #R01041S) in 500ul).
-
bioRxiv - Microbiology 2022Quote: ... A volume of ultrapure water needed to make the reaction up to 37.5μL after the addition of rCutsmart (NEB B6004S) and PspGI (NEB R0611 ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated by precipitation in isopropanol-ethanol 75% and resuspended in 10 μL nuclease free water (NEB, B1500) before quantification by BioDrop μLITE (Biodrop) ...
-
bioRxiv - Genomics 2022Quote: ... and water to make up 49 µl) for three hours at 37°C after which 3 µl NlaII (NEB) was added and the reaction incubated at 37°C for a further three hours ...
-
bioRxiv - Microbiology 2022Quote: ... 160 µL of 40U/µL Taq DNA ligase and 699.36 µL of water (all reagents were purchased from New England Biolabs). 5 µL of the two DNA fragments mixture containing 100 ng of linear pRIT plasmid and a 3-fold excess of inserts were added to 15 µL of Gibson assembly master mix ...
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
Enhancer heterogeneity of lung neuroendocrine tumors reveals sensitivity to FGF signaling inhibitionbioRxiv - Cancer Biology 2023Quote: ... After precipitation RNA was resuspended in appropriate volume of Rnase free water supplemented with RNA inhibitors (New England Biolabs). RNA samples were stored at -80°C until further use ...
-
bioRxiv - Biophysics 2024Quote: ... Reactions were dialyzed with water on silica membranes (0.025-μm pores) for 1 h before transformed into DH10B cells (New England Biolabs). Library sizes of at least 100,000 colony-forming units (cfu ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs; New England BioLabs). Libraries were checked for quality using the Qubit dsDNA HS Assay kit and TapeStation High Sensitivity DNA assay kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs, New England Biolabs) were used ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... and NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs, NEB, E6440) as per manufacturer’s recommendation ...
-
bioRxiv - Developmental Biology 2023Quote: ... in conjunction with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (NEB #E6440S), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... with NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (New England Biolabs E6440S) and polyA enrichment module (NEB E7490S) ...
-
bioRxiv - Microbiology 2024Quote: ... Barcodes (Native Barcoding Kit 96 (SQK-NBD109.96)) were ligated using Blunt/TA Ligase Master Mil (NEB). Barcoded libraries were purified using KAPA Pure Beads (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10µg/ml) and apyrase (25mU/ml, NEB); the suspension was incubated for 1h at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Chromatin digestion was achieved overnight using 1000 units of HindIII (NEB). Digested DNA ends were biotinylated by filling with biotin-14-dATP (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... goat polyclonal anti-UIS4 (LS Biolabs LS-C204260; IFA 1:1000); rabbit polyclonal anti-LISP2 (IFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and probed with either anti-histone H3 (1:1000, NEB, 9715S) or anti-histone H3 (phosphor S10 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 8 µl RNase III (1:1000 diluted, New England Biolabs) or RNase If (1:100 diluted ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 ng of DNA in 50 ul water was used for library preparation using the Ultra II library kit (NEB) as per the manufacturer’s instructions with 6 cycles at the amplification step.
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was eluted from the beads via phenol extraction or heating in water at 80oC for 5 min and ssDNA adapter [Phos]CCACGCGTGCCCTATAGTCGC[Ami] was ligated using T4 RNA ligase (NEB). Libraries were amplified and barcoded via nested and tagged PCR following the original protocol (47 ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed twice with SPRI wash buffer and resuspended in 200 ul of intra-aggragete mix (171 ul water, 1 ul 100 mM ATP, 20 ul 10x NEB T4 DNA Ligase Buffer ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed twice with SPRI wash buffer and resuspended in 50 ul of end fill-in mix (37 ul water, 5 ul 10X NEB Buffer 2 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was eluted in RNase-free water and subsequently treated with Turbo DNase and purified using the Monarch RNA Cleanup Kit (50 µg) (NEB) and eluted in RNase-free water ...
-
bioRxiv - Bioengineering 2021Quote: ... The flow cell was washed with water 3 times and then loaded with EcoRI-HF cocktail (1U EcoRI-HF (R3101, NEB) in 1X CutSmart NEB buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 40 μl of filtered double-distilled water and 20 or 30 μl of Blue Protein Loading Dye (New England Biolabs) were added to the beads or the inputs ...
-
bioRxiv - Cancer Biology 2019Quote: ... Biotinylated blunt ends were then ligated using a ligation reaction (663μl water, 120μl 10X NEB T4 DNA ligase buffer (NEB), 100μl 10% Triton X-100 (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... The pellet was resuspended in 15 µl distilled water and mixed with 10 µl Gel Loading dye 6X (New England BioLabs). The samples were migrated in an 8.5% SDS-polyacrylamide gel at 180 Volts for 120 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the reaction was purified with the Monarch RNA Cleanup Kit (500 micrograms) with elution in 50 µl nuclease-free water (NEB). The quality of the gRNA prep was confirmed by agarose gel electrophoresis and quantified using a NanoDrop One (Thermo Fisher).
-
bioRxiv - Microbiology 2019Quote: ... The cDNA was diluted 1:1 with nuclease-free water and used in Q5® High-Fidelity DNA Polymerase (NEB) reactions (as recommended by the manufacturer ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Genetics 2020Quote: The annealed sgRNA oligos were diluted 1:200 in water and ligated into the pX459 plasmid that has been linearized with restriction enzyme BbsI (New England Biolabs). The ligation mixture contained 2 ul of diluted sgRNA oligos ...