Labshake search
Citations for New England Biolabs :
301 - 350 of 2805 citations for Acetaldehyde 3a 4 5 6 7 7a hexahydro 4 7 methano 1H inden 5 yl oxy since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL High GC Enhancer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL High GC Enhancer (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 5 uL 5X Phusion Buffer (NEB), 10 uL 1M Trehalose (Life Sciences Advanced Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μM Mth RNA ligase (NEB), 1 x adenylation buffer (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... NEB 5-alpha competent E.coli (NEB) were transformed by ligated productions using manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units DNA Pol I (NEB) with water in a total volume of 2x 20 μL ...
-
bioRxiv - Genomics 2024Quote: 5-alpha competent cells (NEB C2987H)
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL 5′-deadenylase (NEB, M0331S) was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... coli NEB-5-alpha (NEB C2987) was used for plasmid cloning ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl 10x rCutSmart buffer (NEB) in a total volume of 50 μl and incubated for 15 min at 65 °C ...
-
bioRxiv - Biophysics 2024Quote: ... NEB 5-ɑ (New England Biolabs) and BL21 (DE3 ...
-
bioRxiv - Cell Biology 2024Quote: ... or NEB 5-alpha HE (NEB) E ...
-
bioRxiv - Genetics 2024Quote: ... 5 μl proteinase K (NEB, P8107) was added and the sample was mixed by pipetting ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Genomics 2024Quote: ... the 5’-end of nascent RNAs was decapped on-beads in RNA 5’ Pyrophosphorylase mix (NEB, M0356S) at 37 °C for 45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: G(5’)ppp(5’)A RNA Cap Structure Analog (New England Biolabs Japan Inc., Tokyo, Japan, #S1406)
-
bioRxiv - Microbiology 2024Quote: ... the RNA was ligated to the 5′-universal RNA adapter (5′GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA3′) using T4 RNA ligase (NEB). After extraction with 25:24:1 phenol/chloroform/isoamyl alcohol and ethanol precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Custom oligos flanking the targeted sites were used to amplify genomic DNA from pooled edited cells (Supplementary Table 7) using High-Fidelity 2× Master Mix (New England Biolabs). Indel frequencies were quantified by comparing unedited control and knockout cell lines using Inference of CRISPR Edits (ICE)73.
-
bioRxiv - Systems Biology 2020Quote: ... One microgram of purified RNA was fragmented at 95 °C for 7 min in 1X T4 RNA Ligase buffer (NEB) with an equal volume of 2X alkaline fragmentation buffer (0.6 volumes of 100 mM Na2CO3 plus 4.4 volumes of 100 mM NaHCO3) ...
-
bioRxiv - Genomics 2020Quote: ... NEBNext Ultra II End-prep reaction buffer (7 μl) and NEBNext Ultra II End-prep enzyme mix (3 μl, both from New England Biolabs) were added to each sample ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR-amplified using primers listed in Supplementary Table 7 and cloned into the px601 plasmid using an NEBuilder HiFi DNA assembly kit (NEB). Similarly ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were gel-purified and used for a second round of PCR amplification (Q5 NEB master mix, 7 cycles) using custom primers to attach Illumina read sequences ...
-
bioRxiv - Biochemistry 2022Quote: AP-DNA was prepared by incubating 50 μM 7-mer ssDNA [d(GTCUGGA]] with 10 U of uracil DNA glycosylase (UDG, New England Biolabs) in UDG Buffer at 37 °C for 1.5 h ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the M8 amplicon were also performed similarly except Q5TM polymerase (5.3×10-7 approximate error/bp; New England BioLabs, USA) was utilized ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
bioRxiv - Molecular Biology 2022Quote: ... A total of 50 unit of T4 DNA ligase along with 7 μl of 20 ng/μl of BSA (Biolabs) and 7 μl of 100 mM ATP were added to reach a final volume of 700μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... We next linearized pattB-DSCP-QF#7-hsp70 (Plasmid #46133)123 using BamHI and NsiI and with Gibson Assembly (NEB) cloned R49E06 promoter in the plasmid.
-
On the causes, consequences, and avoidance of PCR duplicates: towards a theory of library complexitybioRxiv - Molecular Biology 2022Quote: ... Custom P1 adapters containing a 7-bp unique barcodes (Hohenlohe, Bassham, Currey, & Cresko, 2012) were ligated to each individual sample using a T4 ligase (NEB). The 150 robin samples were pooled at equimolar concentrations ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Custom P1 adapters containing unique 7-bp barcodes (Hohenlohe, Bassham, Currey, & Cresko, 2012) were ligated to each individual sample with T4 ligase (New England Biolabs). The DNA from all uniquely barcoded individuals in a library was pooled at equimolar concentration ...
-
bioRxiv - Neuroscience 2024Quote: Total RYR1 transcripts were amplified as 7 overlapping PCR products.38 They were sequenced after fragmentation and library preparation using NEBNEXT NGS workflow (New England Biolabs) according to manufacturer recommendation ...
-
bioRxiv - Genomics 2023Quote: ... all final Illumina compatible ERα STARRseq and ERα-focused STARR-seq capture libraries were prepared by PCR amplification (7 cycles) with NEBNext universal and single indexing primers (NEB), and were sequenced on Illumina NovaSeq 6000 (150bp Paired-End).
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was performed for 7-11 cycles (depending on input DNA concentration) using NEBNext Mulitplex Oligos (New England Biolabs). Indexed sample concentration was quantified using the KAPA Library Quantification Complete Kit (Universal)(Roche) ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: Assessment of the integration status of the HPV-positive HNSCC cell lines was characterized for each cell line and digested with 7 µg of total genomic DNA at 37°C overnight (20 hours) with either EcoRV (New England BioLabs) or Bam HI ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Biochemistry 2023Quote: ... the first round of PCR consisted of 7 cycles of the following program using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Step1 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Ligation was performed on a 7-fold dilution of HindIII-digested chromatin using 100 units of Quick T4 DNA ligase (New England Biolabs) at 16°C for 16 hours ...