Labshake search
Citations for New England Biolabs :
301 - 350 of 6331 citations for 7 Oxabicyclo 2.2.1 hept 2 ene 5 6 6 trifluoro 1 methyl 1R 4S 5S rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Genomics 2021Quote: ... EM-seq libraries from both laboratories were prepared using the NEBNext Enzymatic Methyl-seq (E7120, NEB) kit following manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... a sequencing library was prepared using NEBNext® Enzymatic Methyl-seq Kit (NEB; catalog number E7120S). Library sequencing was performed using NextSeq 2000 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 200 ng DNA using the NEB Enzymatic Methyl-Seq kit (NEB #E7120) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Primer sequences were as previously described.7 Samples were digested with 1 unit of BamHI-HF enzyme (NEB) prior to running the PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 1M MgCl2 and 2 μl of 1 U/μl Xrn1 (M0338, NEB) were added after RNase H digest ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 2 (supplied by NEB, 500 mM Sodium Phosphate, pH 7.5), and 1 μL of PNGase ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl 10x NEBuffer 1 (New England Biolabs), 2 μl 50 mM MnCl2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then pulse labelled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4 µM final concentration ...
-
bioRxiv - Cancer Biology 2022Quote: ... The constructs were subjected to treatment with NEBNext® Enzymatic Methyl-seq (EM-seq™) (NEB, #E7125) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... except that the methyl donor SAM was absent and 0.05 units of inorganic pyrophosphatase (New England Biolabs) were added to improve the efficiency of the reaction ...
-
bioRxiv - Genetics 2023Quote: ... Enzymatic conversion was performed using the NEBNext Enzymatic Methyl-seq Conversion Module (New England BioLabs, Cat#E7125S) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... SssI enzyme in the presence of 160 µM of the methyl donor S- adenosylmethionine (New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Biochemistry 2023Quote: The library was ligated to the barcode oligonucleotide at a 7:1 oligo:library ratio overnight at 16 °C with T4 DNA ligase (New England Biolabs). A no-insert negative control was also ligated overnight using identical conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl 10 mM MnCl2 buffer and 0 or 2 μl lambda phosphatase (NEB #P0753S, USA) in 38 μl supernatant ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 7 μl Polynucleotide Kinase (10 U/µl; NEB) in a total of 100 μl and incubation for 20 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 μL Murine RNase Inhibitor (New England Biolabs, M0314) was added ...
-
bioRxiv - Genomics 2020Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L). The resulting RNA fragments were used for a reverse transcription reaction using Superscript III Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μl of 5 units/µl RNase H (NEB) were added and samples were incubated at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL RNase H enzyme (5 U) (New England Biolabs) was added and the solution was incubated at 44°C for 1 hr ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μL of PaqCI/AarI activator (5 pmol, NEB, S0532S), 1 μL of 10 U PaqCI/AarI (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of rSAP mix (rSAP (1 U, NEB, M0371L) in 1X CutSmart buffer (for MseI/NdeI digestions ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated (200U; NEB)] was added ...
-
bioRxiv - Biochemistry 2021Quote: ... disulfide bonding enhancer 1 and 2 (New England BioLabs), RNase inhibitor (Takara Bio Inc. ...
-
bioRxiv - Genomics 2021Quote: ... or 2 mU DNase 1 (Cat. No. M0303S; NEB) and 0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... Enzymatic conversion was then performed using the NEBNext Enzymatic Methyl-seq Conversion Module (New England Biolabs, Cat. E7125L) following manufacturers protocol (steps 1.5 to 1.9.11 ...
-
bioRxiv - Genomics 2023Quote: ... 200 ng of sheared DNA was processed using the NEBNext Enzymatic Methyl-seq Kit (E7120; NEB, Ipswich, MA) following the manufacturer’s instructions for large insert libraries ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated with 2 nM HaloTag-JF549 and 5 nM SNAP-Cell® 647-SiR (NEB) before imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then incubated at 45 °C for 2 hr with 5 μL of Proteinase K (NEB) in the presence of 40 mM EDTA (pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... mixing with 5 μL of stop buffer (50 mM EDTA and 2 mg/ml Proteinase K (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Biochemistry 2023Quote: ... VCE or FCE::T7RNAP fusion and 5 U/μL vaccinia cap 2′-O-methyltransferase (New England Biolabs). Reactions were carried out at indicated temperatures for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... After CIP inactivation (2 min at 80°C) piRNAs were 5΄end radiolabeled by T4 PNK (NEB) with [γ-32P] ATP (10mCi/mL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl 5x PNK pH 6.5 buffer [350 mM Tris-HCl pH 6.5, 50 mM MgCl2, 5 mM DTT], 1 μl PNK enzyme [NEB] ...
-
bioRxiv - Neuroscience 2024Quote: ... After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) using T4 RNA ligase 1 (New England Biolabs; M0204S), the RT primer was annealed to the 3’-adapter ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...