Labshake search
Citations for New England Biolabs :
301 - 350 of 3658 citations for 6 Aminoindan 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and RpoD control were assessed using the Luna Universal One-Step qRT-PCR kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... thermocycler with the Luna Universal one-step qPCR Master Mix (E3005; New England Biolabs, Ispwich, MA, USA). Amplification reactions for genes of interest were performed in 50 cycles of the following cycling protocol ...
-
bioRxiv - Microbiology 2023Quote: We performed RT-qPCR on select genes using the Luna Universal One-Step Kit (New England Biolabs) and QuantStudio 5 (Thermo) ...
-
bioRxiv - Molecular Biology 2023Quote: ... each gDNA sample was divided into two and one aliquot was digested with StyI-HF (NEB, R3500S). Then ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.5𝜇L of each primer (Where each reaction had non-barcoded primer "Ad1_noMix" and one barcoded primer ’Ad2.1’ - ’Ad2.9’ added) and 25𝜇L NEBNext High-Fidelity 2x PCR Master Mix (NEB) and was run under the following conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold and the cleavage products were resolved by native 1.2% agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2020Quote: ... 6 units of T4 DNA polymerase and 400 units of T4 DNA ligase (NEB) were then added and the reaction was incubated at 12°C for 1 hour to allow second strand synthesis ...
-
bioRxiv - Genomics 2021Quote: ... The decapped RNA was Recapped with 6 μL Vaccinia Capping Enzyme (VCE) (NEB, #M2080) in 1X VCE reaction buffer (50 mM Tris HCl ...
-
bioRxiv - Plant Biology 2019Quote: ... 6 μg of DNA was digested with restriction enzyme EcoRI (New England Biolabs, USA). Digested DNA was separated on 0.8% agarose gel and blotted onto Hybond-N+ nylonmembrane (Amersham Pharmacia Biotech ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 6 μl primers (10 μM) and 50 μl Q5 high fidelity master mix (NEB). The thermocycling parameters were ...
-
bioRxiv - Molecular Biology 2022Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 6-12 µg of genomic DNA was dephosphorylated with rSAP (NEB), followed by AMPure XP beads purification ...
-
bioRxiv - Biophysics 2023Quote: ... The samples were mixed with 6 × purple loading dye without sodium dodecyl sulfate (NEB) and with 10 × TBE to make a 1 × solution ...
-
bioRxiv - Genetics 2019Quote: ... the product was digested for one hour at 37°C using 40 U EcoO109I (New England Biolabs, USA), 5 µL accompanying buffer solution ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). The samples were analyzed using a Lightcycler 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... One of each pair was treated with 0.5 μl of calf intestinal phosphatase (CIP) (New England Biolabs #M0290) before the pair were incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... coli and ligated to one end using Golden Gate assembly with BsmBI and T4 DNA ligase (NEB, Vazyme). All oligos and the corresponding templates used in the cloning for these experiments are outlined in Table S6 ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription and qRT-PCR analysis was performed by Luna universal one- step qRT-PCR kit (NEB # E3005L) with primers list in Table 9.
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Immunology 2021Quote: ... The purified Cxcl1 promoter fragment was equally split into two groups: one treated with M.SssI (New England Biolabs) and the other without M.SssI (“mock” ...
-
bioRxiv - Immunology 2022Quote: ... The qPCR was performed using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with cycling conditions of 10 min at 55°C for reverse transcription ...
-
bioRxiv - Cell Biology 2019Quote: ... One thousand three hundred micrograms of DNA-free RNA were used for cDNA synthesis with random hexamers (NEB) using SuperScript II (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: A total reaction volume of 25μL consisting of 12.5μL of One Taq® 2X Master Mix (New England Biolabs), 0.2 μL of DNA template (< 1000 ng) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 ng RNA were used for analysis with the LUNA one-step RT-qPCR kit (LUNA E3005L Biolabs). The relative expression levels of the mRNA of interest were determined by real-time PCR using Quantifast SYBR Green Mix (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: ... The RT-PCR detection was conducted by using the Luna Universal One-Step RT-qPCR kit from NEB and following its protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Regions of interest were amplified by PCR using a One-Taq Hot Start DNA-polymerase (New England Biolabs) with standard buffer and 3% DMSO and the following primers targeting exon2 (L ...
-
bioRxiv - Microbiology 2022Quote: ... Detection of selected targets was performed with Luna® Universal One-Step RT-qPCR (New England BioLabs Inc.) according to manufacturers protocol using specific primers ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2022Quote: ... This was followed by one round poly(A) purification using oligo d(T) magnetic beads (New England Biolabs). 1.5-2 µg of mRNA was fragmented to 100-150 nts using RNA Fragmentation Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Plasmid DNA containing one copy of the SIV gene was linearized using EcoR1 (New England Biolabs, Ipswich, MA) following their restriction digest protocol (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis and qRT-PCR were performed simultaneously using the Luna Universal One-Step RT-qPCR kit (NEB) with the Quantstudio 7 Flex (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA synthesis and RT-qPCR was carried out using Luna® Universal One-Step RT-qPCR Kit (NEB) according to the manufacturer’s instructions with 100 ng of mRNA ...
-
bioRxiv - Bioengineering 2023Quote: ... cloning was achieved via one-pot restriction-ligation reactions with type IIS restriction enzymes (NEB or Thermo Scientific) and T4 DNA ligase (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... RNA expression levels were quantified using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs #E3005L) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Microbiology 2023Quote: PCR was carried out using NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, E3006) or Taqman Fast Universal PCR master mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... one cell stage zebrafish embryos were injected with 50 nM EnGen® Lba Cas12a (Cpf1) (New England Biolabs) and each gRNA at a final concentration of 2 nM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of DNA template in 25 µl of 1x One Taq Standard Buffer (Biolabs, Ipswich, MA, USA), 0.2 mM dNTPs ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was then directly used in the Luna® Universal One-Step RT-qPCR Kit (New England BioLabs). Primers listed in supplemental table 10.
-
bioRxiv - Cell Biology 2024Quote: ... one of the immunoprecipitated samples was treated with 400 units of Lambda protein phosphatase (New England Biolabs, P0753S) at 30 °C for 30 min ...
-
bioRxiv - Synthetic Biology 2021Quote: ... total DNA from one clone was isolated using the Monarch Kit for HMW DNA Extraction from Bacteria (NEB#T3060) and confirmed by Nanopore sequencing.
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative RT-PCR was performed using Luna Universal One-Step RT-qPCR kit (New England Biolabs, Ipswich, MA, USA) according to manufacturer’s protocol using Agilent Mx3000P instrument ...
-
bioRxiv - Microbiology 2022Quote: ... Five microliters of the mixture was added to Luna Universal Probe One-Step RT- qPCR mixture (NEB, MA, USA) to a final volume of 20 µl ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned using one unit each of Exonuclease I and Antarctic Phosphatase (New England Biolabs, Massachusetts, USA), with sequencing reactions performed using an ABI3730 Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... The membrane fraction was then incubated with one of the three deglycosylation enzymes: O-Glycosidase (New England Biolabs, #P0733), PNGase F (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Poly(A) RNA was isolated using one round of selection with oligo(dT)25 magnetic beads (New England Biolabs). This resulted in approximately 10 μ g of poly(A ...
-
bioRxiv - Plant Biology 2020Quote: ... 100ng of each entry and destination vector are assembled in one reaction mix containing 10U BsaI-HF-v2 (NEB), 200U T4 Ligase (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (M300, New England Biolabs). The samples were analyzed using a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... using the IP4 set of primers and probe as described on the WHO website (https://www.who.int/docs/default-34source/coronaviruse/real-time-rt-pcr-assays-for-the-detection-of-sars-cov-2-institut-35pasteur-paris.pdf?sfvrsn=3662fcb6_2) and the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, France).