Labshake search
Citations for New England Biolabs :
301 - 350 of 6524 citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... dA-tailing was performed by incubating the chromatin-bead mixture for 1 hour at 37 °C with 1× NEB Buffer 2 (NEB, B7002), 0.5 mM dATP ...
-
bioRxiv - Biochemistry 2020Quote: ... pre-tRNA stock was diluted 1 in 2 into RNA loading buffer (New England Biolabs) and separated on a 10% acrylamide urea-TBE denaturing gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs, USA) at 65 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2 (NEB E7335S & E7500S). In order to increase input DNA above single library limits (1 μg ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 1-2 µg phi47 DNA was treated with Nucleoside Digestion Mix (New England Biolabs) following the manufacturer’s protocol at 37°C for >2h ...
-
bioRxiv - Microbiology 2024Quote: ... with NEBNext® Multiplex Oligos for Illumina Dual Index Primers Sets 1 and 2 (NEB). Manufacturer’s instructions were followed except the post-ligation bead clean-up ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biophysics 2024Quote: Purified RNA 3xUCUCU (10 pmol) was first 5’-end dephosphorylated by 5 units of antarctic phosphatase (NEB, 5 U/µL) in antarctic phosphatase buffer (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Molecular Biology 2024Quote: ... ribonucleotides (6 mM ATP, 5 mM CTP, 5 mM GTP; NEB®), 5 mM N1-methylpseudouridine-5’-triphosphate (TriLink® BioTechnologies ...
-
bioRxiv - Biophysics 2021Quote: ... 1 μL of this PCR reaction was then combined with 5 μL Q5 buffer (NEB, cat#M0491S), 0.5 μL 10mM DNTP (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and then added up to 5 fmol DNA (2000:1000:1 RNA:protein:DNA ratio) and NEBuffer 3.1 (NEB) to 1X ...
-
bioRxiv - Biochemistry 2020Quote: ... Fragmentation of 1 µg mRNA aliquots for 5 min at 94°C in 1x Fragmentation Buffer (NEB) was optimal to obtain a pool of 100-200 nt fragments ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of 5 μM annealed adaptors and 10 μL of Blunt/TA ligase master mix (NEB) was added to each reaction ...
-
bioRxiv - Developmental Biology 2020Quote: ... Free adaptor was then removed by addition of 1 μL 10 U/μL 5’-Deadenylase (NEB, M0331S). 1 μL 10 U/μL RecJ Exonuclease (Lucigen/Epicentre ...
-
bioRxiv - Microbiology 2023Quote: ... pETduet-1::5′-flank_SpecPromoter_kanR_3′-flank and were subsequently digested from the plasmid using BamHI and NotI (NEB). The resultant insert (5′-flank_SpecPromoter_kanR_3′-flank ...
-
bioRxiv - Genetics 2022Quote: ... The 5’ adaptor (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to the product using T4 RNA ligase 1 (NEB) at 15 °C for 4 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl of each sample was mixed with 1 µl of 6X Purple Gel Loading Dye (NEB) and electrophoresed at 110 V for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Embryos were injected with 1 mg of gRNA and 5 μ M of Cas9 protein (NEB, 10128356) at 1-cell stage ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The base plasmid was digested with BmtI and XbaI (Library 1) or BsaI (Library 2) and purified on a 1% agarose gel using Monarch® DNA Gel Extraction Kit (NEB, T1020L). We used a Gibson Assembly reaction (NEBuilder® HiFi DNA Assembly Master Mix ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ deadenylase enzyme (NEB) and incubated at RT overnight ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ligation was performed by adding 1 unit of T4 RNA Ligase 2 enzyme (New England Biolabs) in 10 μl of 1X reaction buffer and incubating the reaction at 37°C for 60 min ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM each of gene- specific forward and reverse primers and 1 unit Phusion polymerase (NEB) were mixed in 1X HF Phusion buffer and 3% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Genomics 2023Quote: 1-2 µg of extracted total RNA and polysomal RNA was treated with DNaseI (NEB, M0303) in a 100 µL reaction at 37 °C for 15 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2; New England Biolabs). Number of PCR cycles was calculated using a real-time qPCR-based approach (Lion et al. ...
-
bioRxiv - Genetics 2024Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2; NEB E7335 and E7500). Library DNA was quantified using the Qubit ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gels were sealed in a plastic bag and hybridized at 37 °C overnight with a 5′-(CCCTAA)5−3′ telomeric oligonucleotide probe 5′-end-labeled with T4 polynucleotide kinase (NEB M0201S) and [γ-32P]ATP (PerkinElmer BLU502A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... After signal detection membranes were stripped and re-hybridized overnight at 50 °C with oligonucleotides detecting β-actin (5’-GTGAGGATCTTCATGAGGTAGTCAGTCAGGT-3’) and U6 (5’-GGAACGCTTCACGAATTTGCGT-3’) 5’-end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP ...