Labshake search
Citations for New England Biolabs :
301 - 350 of 6611 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... A 20 µL Gibson Assembly reaction was performed with 50 ng of vector at a 2:1 ratio for 1 hour (New England Biolabs NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Plant Biology 2022Quote: Nucleic acids were digested using the Nucleoside Digestion Mix (NEB) with the following modifications ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the Monarch Nucleic Acid Purification Kits (T1020 and T1030, NEB) were used ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Biophysics 2021Quote: ... 1 μL of this was then combined with 5 μL Q5 buffer (NEB, cat#M0491 S), 0.5 μL 10mM DNTP (Thermo Scientific ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN, N is for a random nucleotide) by T4 ligase 1(NEB) sequentially ...
-
bioRxiv - Genomics 2020Quote: ... each eluted insert was mixed with 50ng pDXinit-PAC in a molar ratio of 1:5 (vector:insert) in 10μl reactions and digested with 0.5μl SapI (NEB) for 1h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl 10 pM/μl and previously adenylated using the 5′ DNA adenylation kit (NEB, E2610S), and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs, 5 U μg-1 of protein) were added with gentle mixing after each addition ...
-
bioRxiv - Plant Biology 2022Quote: ... We then ligated single-stranded rP5_RND adapters to 5’-ends with T4 RNA ligase 1 (NEB). Ligated RNAs were enriched and captured by oligo(dT ...
-
bioRxiv - Microbiology 2024Quote: ... 5 units (2.5 μL) of RNase free DNAse I (NEW ENGLAND BioLabs, 2000 u. mL-1) and 100 μL of nuclease free water was added for every 10 μg of RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... These were eluted and precipitated before ligation to 5’ adapters (1× T4 RNA ligase buffer (NEB), 0.5 µM p10IllLigup adapter ...
-
bioRxiv - Genetics 2024Quote: ... 4) IDS-KO receiving 1 mg/kg idursulfase IV and nebulized idursulfase (KO-NEB, n = 5). The nebulized idursulfase was delivered as 167 µL of 2 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RT-PCR or qPCR was performed with 1 μl of 1:2 diluted cDNA using the Q5®Hot Start High-Fidelity 2X Master Mix (NEB) or the SYBR™ Green PCR Master Mix (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... dA-tailing was performed by incubating the chromatin-bead mixture for 1 hour at 37 °C with 1× NEB Buffer 2 (NEB, B7002), 0.5 mM dATP ...
-
bioRxiv - Biochemistry 2020Quote: ... pre-tRNA stock was diluted 1 in 2 into RNA loading buffer (New England Biolabs) and separated on a 10% acrylamide urea-TBE denaturing gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs, USA) at 65 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2 (NEB E7335S & E7500S). In order to increase input DNA above single library limits (1 μg ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 1-2 µg phi47 DNA was treated with Nucleoside Digestion Mix (New England Biolabs) following the manufacturer’s protocol at 37°C for >2h ...
-
bioRxiv - Microbiology 2024Quote: ... with NEBNext® Multiplex Oligos for Illumina Dual Index Primers Sets 1 and 2 (NEB). Manufacturer’s instructions were followed except the post-ligation bead clean-up ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biophysics 2024Quote: Purified RNA 3xUCUCU (10 pmol) was first 5’-end dephosphorylated by 5 units of antarctic phosphatase (NEB, 5 U/µL) in antarctic phosphatase buffer (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Molecular Biology 2024Quote: ... ribonucleotides (6 mM ATP, 5 mM CTP, 5 mM GTP; NEB®), 5 mM N1-methylpseudouridine-5’-triphosphate (TriLink® BioTechnologies ...
-
bioRxiv - Biophysics 2021Quote: ... 1 μL of this PCR reaction was then combined with 5 μL Q5 buffer (NEB, cat#M0491S), 0.5 μL 10mM DNTP (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and then added up to 5 fmol DNA (2000:1000:1 RNA:protein:DNA ratio) and NEBuffer 3.1 (NEB) to 1X ...
-
bioRxiv - Biochemistry 2020Quote: ... Fragmentation of 1 µg mRNA aliquots for 5 min at 94°C in 1x Fragmentation Buffer (NEB) was optimal to obtain a pool of 100-200 nt fragments ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of 5 μM annealed adaptors and 10 μL of Blunt/TA ligase master mix (NEB) was added to each reaction ...
-
bioRxiv - Developmental Biology 2020Quote: ... Free adaptor was then removed by addition of 1 μL 10 U/μL 5’-Deadenylase (NEB, M0331S). 1 μL 10 U/μL RecJ Exonuclease (Lucigen/Epicentre ...
-
bioRxiv - Microbiology 2023Quote: ... pETduet-1::5′-flank_SpecPromoter_kanR_3′-flank and were subsequently digested from the plasmid using BamHI and NotI (NEB). The resultant insert (5′-flank_SpecPromoter_kanR_3′-flank ...
-
bioRxiv - Genetics 2022Quote: ... The 5’ adaptor (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to the product using T4 RNA ligase 1 (NEB) at 15 °C for 4 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl of each sample was mixed with 1 µl of 6X Purple Gel Loading Dye (NEB) and electrophoresed at 110 V for 30 minutes ...