Labshake search
Citations for New England Biolabs :
301 - 350 of 3658 citations for 2 Triisopropylsilyl Oxazole 5 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 50 ng PCR product was incubated with 2 µL 10X NEBuffer 2 (NEB, B7002S) and nuclease-free water adding up to 19 µL using the following program ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 1M MgCl2 and 2 μl of 1 U/μl Xrn1 (M0338, NEB) were added after RNase H digest ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Genomics 2024Quote: ... the 5’-end of nascent RNAs was decapped on-beads in RNA 5’ Pyrophosphorylase mix (NEB, M0356S) at 37 °C for 45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: G(5’)ppp(5’)A RNA Cap Structure Analog (New England Biolabs Japan Inc., Tokyo, Japan, #S1406)
-
bioRxiv - Microbiology 2024Quote: ... the RNA was ligated to the 5′-universal RNA adapter (5′GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA3′) using T4 RNA ligase (NEB). After extraction with 25:24:1 phenol/chloroform/isoamyl alcohol and ethanol precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 30 min at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... α2-3,6,8,9 neuraminidase A (NEB), LB Broth (BD Difco™) ...
-
bioRxiv - Microbiology 2020Quote: ... 2) NEB Q5 (NEB M0491), 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... T4 RNA ligase 2 (NEB) and RiboLock RNase inhibitor (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... 2 U DNase I (NEB) was added to IVT mixture and further incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 1 h at 37°C and resolved on a denaturing urea polyacrylamide gel (20% ...
-
bioRxiv - Microbiology 2021Quote: ... in 1× NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... in 1x NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of BSA (NEB), 15 μl of dNTPs 10 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL ATP (NEB, B0202S), 2 μL 10X restriction digest buffer (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and set 2 (NEB #7500S) according to the manufacturer’s protocol with minor modifications as noted below ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Set 2 (E7500S, NEB). Quality of the final library preparation was analysed on the Bioanalyzer using the High Sensitivity DNA reagents kit and cassettes (5067-4626 ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM ATP) (NEB) at 30 °C for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... with 2 mM MgCl2 (NEB), 0.2mM dNTPs (made in house) ...
-
bioRxiv - Genetics 2024Quote: ... 2 μl of DpnII (NEB) was added to digest the chromatin overnight at 37 °C with shaking at 900 rpm and deactivated at 65 °C for 20 min.
-
bioRxiv - Physiology 2024Quote: ... with 1x GlycoBuffer 2 (NEB), 5 μL of O-glycosidase (40,000 U/μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10X NEB buffer 2 (NEB) was added to 200 ng DNA and PCR products were denatured to single strands by heating at 95°C for 5 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U RNase H (NEB) was added to hydrolyze the RNA at 37°C for 15 min ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL NEBuffer 2 (NEB), 2.8 µL H2O and 0.2 µL Therminator IX (NEB ...
-
bioRxiv - Genomics 2024Quote: ... in 1x NEBuffer 2 (NEB) in a final volume of 10 µL ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µL T4 ligase (NEB), 4 µL 10x T4 ligase buffer (NEB) ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7.5 µl m7G(5′)ppp(5′)G RNA Cap Structure Analog (10 μmol) (New England BioLabs, Ipswich, MA), 2 µg linearized DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 ml of virus was incubated with 1 ml DNase I (NEB, 2 units/ml), 4 µL DNase I buffer ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...