Labshake search
Citations for New England Biolabs :
301 - 350 of 5065 citations for 2 4 Chloro 2 tetradecylphenoxy N 3 5 dichloro 2 hydroxy 4 methylphenyl acetamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RP1 primer (NEB), 1 µL ddH2O and PCR amplified for 16-18 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RPI primer (NEB), 2 µL 10 µM RP1 primer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10×T4 ligase buffer (NEB), 0.2 μl 0.1 M ATP (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl T7 RNA Polymerase Mix (NEB) in a total of 20 μl ...
-
bioRxiv - Genomics 2023Quote: ... and 2 mM VRC (New England Biolabs) for 7 min on ice and stored in 70% ethanol ...
-
bioRxiv - Biophysics 2023Quote: ... in NEBuffer 2 (New England Biolabs #B6002) at 37°C for 30 minutes followed by column purification ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 mM VRC (New England Biolabs).
-
bioRxiv - Bioengineering 2024Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 μL of T4 DNA ligase (NEB) were added and incubated at RT for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μL of Murine RNase Inhibitor (NEB) and 5 μL of Baseline-ZERO DNase were added to each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 µL 100 mM dNTPs (NEB) and heated at 65° C for 5 minutes ...
-
bioRxiv - Immunology 2024Quote: ... and 2 µL of Proteinase K (NEB)) ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL (40 U) Exo I (NEB) was added ...
-
bioRxiv - Genomics 2024Quote: ... 2 U/µL Phusion polymerase (NEB #M0530S), 10% formamide ...
-
bioRxiv - Genomics 2024Quote: ... and 2 µL 10x ThermoPol Buffer (NEB) in a total volume of 20 µL and was incubated for 30 min or overnight at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 2 pg of lambda-DNA (NEB, N3011S ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μl 10% NP-40 (NEB, B2704S), 5 μl H2O and 1 μl PNGase F (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ ends were hydroxy-repaired by adding T4 polynucleotide kinase reaction mix (NEB) which was incubated for 45 minutes at 37 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Biochemistry 2021Quote: ... sDrl-2 for crystallization was also partially deglycosylated with PNGase F (New England BioLabs: 2,000 unit/mg sDrl-2) for 3 h at room temperature before sizing.
-
bioRxiv - Biochemistry 2021Quote: ... 2 μl of this lysate was directly used for PCR reactions with 2× Taq start master mix (M0496L, NEB), and the two NASP clone screening primers (see primer table) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... These were phosphorylated (2 μL 100 μM oligo stock, 2 μL 10X T4 DNA ligase buffer (New England Biolabs), 1 μL T4 PNK (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 nM dT adaptor primer and 200 nM Vλ1-GSP4-2-Hind III and 2 U Taq polymerase (NEB), in a final volume of 50 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μl each of two complementary oligonucleotides (Mut_sgRNA_F and Mut_sgRNA_R) (Supplementary file 1) at a concentration of 20 μM and 2 μl of NEBuffer 2 (NEB B7002S) were added into an Eppendorf tube ...
-
bioRxiv - Microbiology 2024Quote: ... The gel-extracted nascent RNA in 5 µl nuclease-free water was ligated to 10.7 pmol barcode DNA linker (Supplementary Table 2) using 200 U truncated T4 RNA ligase 2 (NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2021Quote: ... and 4 μl 5 U/μL I-SceI (NEB, #R0694L) in a 50 μL final volume for 3 hours at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Immunology 2020Quote: ... 1 mM ATP and 3 units of T4 DNA ligase for 2 h at RT (all from NEB). Next ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µL NEB Ultra II End-prep Enzyme Mix and 2 µL NEBNext FFPE DNA Repair Mix (NEB) were added to the DNA (final volume 60 µL) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated with 2 nM HaloTag-JF549 and 5 nM SNAP-Cell® 647-SiR (NEB) before imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then incubated at 45 °C for 2 hr with 5 μL of Proteinase K (NEB) in the presence of 40 mM EDTA (pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... mixing with 5 μL of stop buffer (50 mM EDTA and 2 mg/ml Proteinase K (NEB)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... After CIP inactivation (2 min at 80°C) piRNAs were 5΄end radiolabeled by T4 PNK (NEB) with [γ-32P] ATP (10mCi/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... VCE or FCE::T7RNAP fusion and 5 U/μL vaccinia cap 2′-O-methyltransferase (New England Biolabs). Reactions were carried out at indicated temperatures for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... then combined with 5 μM dNTPs and 2 μL of 10× rCutSmart buffer (NEB, Ipswich, MA, USA) in a total reaction volume of 17 μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragments were dephosphorylated by adding 5 μL antarctic phosphatase buffer and 2 μL enzyme (NEB cat#M0289S) and incubating for 1 h at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Biophysics 2020Quote: For the insertion of an ATTO647N-labeled oligonucleotide complementary to the position 14711 bp from the biotinylated end of the λ DNA we employed the previously described strategy14 and followed the more recently described procedure.15 2 μg of λ DNA was incubated for 2 hours with the nicking enzyme Nt.BstNBI (20 units, NEB) at 50 °C in the nickase buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR product (2 μg) and pEYFP-C1 vector DNA (2 μg) were digested with BamHI-HF and HindIII-HF (New England Biolabs) according to the manufacturer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The annealing was carried out in 96-well PCR plates by mixing 2 μL of each oligonucleotide at 100 μM with 2 μL of 10x T4 DNA Ligase Reaction Buffer (NEB) and 14 μL of water ...
-
bioRxiv - Systems Biology 2021Quote: ... PCR reactions with plasmid and genomic DNA templates were performed using the Phusion High-Fidelity 2× Master Mix or Q5 High-Fidelity 2× Master Mix (New England Biolabs) according to the manufacturer’s protocol ...