Labshake search
Citations for New England Biolabs :
301 - 350 of 2954 citations for 2' Methyl 3 phenylpropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... 5’-AGCTACCGACAACAACGTGT-3’ and Cap9_ Kpn/Age_Rev: 5’-AGAAGGGTGAAAGTTGCCGT-3’ and Phusion High-Fidelity PCR kit (New England Biolabs). The amplicon was gel purified digested with KpnI ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Immunology 2022Quote: ... and we digested up to 3 μg of DNA with 3 μl of EcoRI-HF restriction enzyme (New England Biolabs) per 50 μl.
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Microbiology 2021Quote: ... were generated by PCR amplification of either full-length pfget4 or nucleotides encoding for the first 246 amino acids of PfGet2CD using PfGet4-EcoRIF (5’-GTACCGGAATTCATGAAAAAGTTCAAATTTAGTAAAGAAAAGCTAGCC-3’)/PfGet4-XhoISalIR or PfGet2CD-BamHIF (5’-GTACGCGGATCCATGGATAAAAATACATTAAAAAGAA-3’)/PfGet2CD-XhoISalIR (5’-AGACCGGTCGACCTCGAGTTATTCATGTTTCGTAATAATAAATTG-3’) primer pairs and subsequently cloning at corresponding sites in pMALc2X plasmid (New England Biolabs).
-
bioRxiv - Cell Biology 2022Quote: ... A 3’ RNA adapter /5’Phos/rArGrArUrCrGrGrArArGrArGrCrArCrArCrGrUrC/3’SpC3 was ligated to the samples using T4 RNA Ligase (NEB, M0437M) at room temperature for 75 min.
-
bioRxiv - Molecular Biology 2022Quote: ... 1000 ng of DNA diluted in 27 μL of nuclease-free water was dephosphorylated by the addition of 3 μL of 10X CutSmart Buffer and 3 μL of Quick Calf Intestinal Phosphatase (NEB) and then incubated at 37ºC for 10 minutes ...
-
bioRxiv - Biophysics 2022Quote: ... the purified 8.2 kb DNA linker was annealed to the oligo DNA handle with 3’-biotin (5’-TGGACTGATGCGGTATCTGCGATATCCTA CGCAGGCGTTT-3’-biotin) in PBS at room temperature for 3 hr followed by purification using Monarch DNA purification kit (NEB).
-
bioRxiv - Genetics 2022Quote: ... was assessed via PCR amplification using OneTaq 2x Master Mix (forward primer DLO1142 5’-ACCCATTTCCCATTCAATCA-3’ reverse primer DLO1143 5’-TTGTAATCTGCCCCAAAAGG-3’) and subsequent HpaII restriction digest (New England Biolabs). DLW135 carried a wild type allele of pho-9 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR mutagenesis to create site-directed mutants of malM 3’-UTR and cspE 3’-UTR was conducted with the Q5 site-directed mutagenesis kit (New England Biolabs) using end-to-end primers designed with NEBaseChanger ...
-
bioRxiv - Genomics 2020Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends using Klenow fragment (3’ to 5’ exo minus, New England Biolabs). Precipitated DNA was incubated with adaptors at room temperature for 1 hr with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends using Klenow fragment (3’ to 5’ exo minus, New England Biolabs). Precipitated DNA was incubated with adaptors at room temperature for 1 h with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... sfgfp was cloned in-frame with tssB and a short linker (encoding 3×Ala 3×Gly) by Gibson Assembly (New England Biolabs) into pNCC1-Spec to allow IPTG-inducible expression of TssB-sfGFP ...
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
bioRxiv - Microbiology 2021Quote: 16S rRNA gene regions V3-V4 were amplified with primers 314F (5’-CCTAYGGGRBGCASCAG-’3) and 806R (5’-GGACTACNNGGGTATCTAAT-3’) with Phusion High-Fidelity PCR Master mix (New England Biolabs) and amplified products were verified using Agilent 5400 Fragment analyser ...
-
bioRxiv - Biochemistry 2021Quote: ... specific to the 5′ and 3′ RNA adapter sequence (Table 3) and PCR amplified the whole cDNA using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fragment was amplified by PCR using primers piLepF1 (5“-TCTACAAATCATAAAGATATTGGAAC-3”) and LepR1 (5“-TAAACTTCTGGATGTCCAAAAAAATCA-3”) (Hebert et al., 2004) using OneTaq Mastermix with standard buffer (New England Biolabs) under standard cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Systems Biology 2023Quote: ... 3’ ends of RNA were modified to have 3’ OH groups compatible for ligation using T4 Polynucleotide Kinase (NEB, #M0201L). Beads were incubated at 37°C for 10 minutes with shaking at 1200 rpm on a ThermoMixer ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... and a pair of oligonucleotides (Forward, 5’-CACCGTCAATAATGAGGTGGTCCGA-3’; Reverse, 5’-AAACTCGGACCACCTCATTATTGAC-3’) was ligated with T4 DNA Ligase (M0202, New England BioLabs).
-
bioRxiv - Bioengineering 2023Quote: ... The β2-tubulin locus was amplified with the 1114A.S43 (5’ GAGAGCAACACTCGTGCG 3’) and 1114A.S44 (5’CAGGGTGGCATTGTACG 3’) primers and the amplicon was digested with Fspl (NEB cat#R0135S) or Ddel (NEB cat#R0175S ...
-
bioRxiv - Microbiology 2022Quote: ... (5’-Phos-GAUCGUCGGACUGUAGAACUCUGAAC-3’-InvdT) was ligated to the 3’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 h) the cells were incubated in 3 µM SNAP-Cell TMR-Star (New England Biolabs Inc., Boston, MA, USA) in 10% FBS DMEM for 30 min and embedded using Vectashield (supplemented with DAPI).
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Genetics 2022Quote: ... 5’-TTAGAAGAACCGGTCTTCAGTATG-3’ and 5’-CTGTAGGCAAGAAAGCAGAGTATTGTCA-3’) on genomic DNA of pooled or individual embryos followed by digest with XhoI (NEB). Following validation of knock-in ...
-
bioRxiv - Neuroscience 2022Quote: ... primers 5’ caccGGAACAGGCAACATGATTGA 3’ and 5’ aaacTCAATCATGTTGCCTGTTCC 3’ were annealed and golden gate assembled using BpiI (Thermo Fischer) and T4 Ligase (NEB) into s23_U6_scaffoldv2 backbone having BpiI cut sites downstream of U6 promoter.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was eluted in 17μl of water and further 3’ A-tailed using 2.5 units of Klenow 3’ to 5’ exo(-) (NEB, cat M0212) in 1X NEB buffer 2 supplemented with 0.2 mM dATP for 30 minutes at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Immunology 2024Quote: ... and 1.2 nmol of the puromycin linker (5’-/5Phos/-d(A)21-(C9)3-d(ACC)-puromycin-3’) by the T4 DNA ligase (New England Biolabs) in a 100 µL reaction for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Genetics 2024Quote: RNP was complexed by addition of 1 μl of 10 uM Cas9 with 3 μl of 10 uM gRNA in 3 μl NebBuffer r3.1 (NEB B6003S) and 20 μl DNAse/RNase free water ...
-
bioRxiv - Cell Biology 2024Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in TTpl503 [mec4p::Lamp-1::GFP]
-
bioRxiv - Developmental Biology 2024Quote: ... pax9el622 fish were genotyped using primers F3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and R3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and Bsrl digestion (New England Biolabs), producing digested wild-type bands (611 and 186 bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µL (12 units) M.SssI methyltransferase (NEB). This solution was pre-warmed to 37°C before addition to prevent interference with dCas9:gRNA binding to the DNA ...
-
bioRxiv - Biochemistry 2020Quote: ... in NEB buffer #3 (New England Biolabs, B7003S) for 30 min at 37°C and then ethanol-precipitated after phenol:chloroform and chloroform extraction ...