Labshake search
Citations for New England Biolabs :
301 - 350 of 7444 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was diluted 1:10 and 3 µl of diluted cDNA was used as input for qPCR using Luna by NEB master mix for a 20 µL total reaction ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2023Quote: ... and A-tailed with Klenow Fragment (3’-to-5’ exo-, New Englands Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.5 μl Klenow fragment (3′ to 5′ exo-, Cat. #M0212L; New England Biolabs) and 0.5 μl T4 Polynucleotide Kinase (Cat ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired oligos (sgRNA-F and sgRNA-R; see Table S8) with 5′ overhangs were first treated with T4 polynucleotide kinase (NEB, M0201), then cooled from 95°C to 4°C at a 0.1°C/sec ramp rate ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Bioengineering 2024Quote: ... This strategy avoids 3’-terminal editing of the mismatched primers by the 3’-5’ exonuclease activity of Q5® High-Fidelity DNA Polymerase (NEB), increasing PCR specificity.61
-
bioRxiv - Molecular Biology 2024Quote: ... was used to repair the sonicated DNA and successively 3’ A-tails were added by Klenow Fragment (3’→5’ exo-) (NEB, M0212S) and dATPs (NEB ...
-
bioRxiv - Systems Biology 2020Quote: ... Broad Range (11-245 kDa) (New England Biolabs, #P7712S). Lysates were run in 1x Tris-Glycine (Thermo ...
-
bioRxiv - Genomics 2022Quote: ... 11 μL T4 DNA Ligase (400 U/μL, NEB), 2 μL RNase inhibitor (40 U/μL ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Biophysics 2024Quote: ... N-glycosylation was removed by a 1-hour incubation with PNGase F (500 U, NEB) and following digest with sequence-grade trypsin (Promega ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.5 and de-N-glycosylated using 500 U N-glycosidase F (PNGase F, New England Biolabs) for 12 h at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... then deglycosylated with 2000 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA). All samples were incubated for 16 hours at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% DMSO and 10 units of λ exonuclease (NEB, M0262S) at 37°C for 30 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 10 μl of 5 U/μl Klenow (NEB M0210)) and incubating 1h at 37ºC with rotation ...
-
bioRxiv - Developmental Biology 2024Quote: ... mixed with 3 μl 10% SDS and 1.8U Proteinase K (NEB #P8107S) and incubated overnight at 55°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of RNA were mixed with 2 μl of 100 μM PvG748-SBS12-RT random hexamer primer (Supplementary Table 3) and 1 μl of 10 mM dNTP mix (NEB, N0447S), incubated for 3 minutes at 65 °C and transferred to ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were incubated with 50 μM dATP and 5 U of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212) in 30 μl 1 × NEBuffer2 at 37°C for 30 minutes.
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Biophysics 2020Quote: ... and 7U/mL Klenow Fragment of DNA Polymerase I (3’-5 exo-) (NEB, M0212). Reactions were incubated at 37°C and incorporation of labeled dCMP was monitored by an acid precipitation assay ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...