Labshake search
Citations for New England Biolabs :
3401 - 3450 of 10000+ citations for Rat Insulin Like Growth Factor 1 IGF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Small RNA libraries were prepared using the NEBNext Small RNA Library Prep kit (NEB), with some modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the NEB Monarch Total RNA Miniprep Kit (#T2010, New England Biolabs, United Kingdom) respectively ...
-
bioRxiv - Zoology 2023Quote: ... or the Genome Institute of Singapore (GIS) using NEBNext DNA Library Preparation Kits (NEB). Paired-end sequencing was performed on Illumina Miseq (2x300-bp or 2x250-bp ...
-
bioRxiv - Biochemistry 2024Quote: All PCR was performed with Q5 High-Fidelity DNA Polymerase kit (New England Biolabs) according to manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... the collected cell pellets were processed using Monarch RNA extraction kit (New England BioLabs). The RNA samples were then quantified with nanodrop and normalized before cDNA synthesis (Lambda Biotechnologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... the NEB Next® Ultra RNA Library Prep Kit for Illumina (E7530L, NEB, USA) was used ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by library preparation using NEBNext Ultra II RNA Library Preparation Kit (NEB, E7770S). Libraries were paired-end sequenced with read lengths of 150 bp on Illumina HiSeq X Ten or Nova-seq instruments ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was depleted of rRNA using the Illumina rRNA Depletion Kit (NEB #E6310) and then prepared for Illumina sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina #E7760 per the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs). qPCR was performed on a LightCycler 480 real time PCR system (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit (NEB) and sequenced on the HiSeq 2500 Sequencing System (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library prep kit (New England Biolabs) following manufacturer’s instructions for H3K9ac CUT&RUN DNA ...
-
bioRxiv - Systems Biology 2024Quote: ... the enzyme’s activity was immediately neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). Subsequently ...
-
bioRxiv - Synthetic Biology 2023Quote: ... after which DNA was extracted using Monarch genomic DNA purification kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Cat. # E2040S), template concentration 10 nM ...
-
bioRxiv - Microbiology 2024Quote: ... The purified products were quantified using the NEBNext Library Quant kit for Illumina (NEB) and sequenced using a mid-output reagent cartridge with 2×150 paired-end reads on an Illumina Miniseq platform ...
-
bioRxiv - Microbiology 2024Quote: ... cells were lysed and RNA purified using the Monarch Total RNA Miniprep Kit (NEB) according to the manufacturer’s instructions except that the on-column DNase treatment was omitted ...
-
bioRxiv - Pathology 2024Quote: ... 5 min ice) and plasmids were extracted using the Monarch Plasmid Miniprep kit (NEB) following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted using the Monarch Total RNA miniprep kit (New England Biotechnologies (NEB) #T2010 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the library for sequencing was constructed with FS DNA Library Prep Kit (NEB, E7805) by following the manual instructions ...
-
bioRxiv - Genomics 2024Quote: The ligation product was purified using a Monarch PCR & DNA Cleanup Kit (NEB #T1030) following the manufacturer’s recommended protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... pBBR1-E and pBBR-EV were extracted using Monarch Plasmid Miniprep kit (#T1010; NEB) and following supplier’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... followed by in vitro transcription with the T7 High Yield RNA Synthesis kit (NEB). Newly synthesized sgRNAs were purified using the MEGAclear kit (Life Technologies) ...
-
bioRxiv - Genetics 2024Quote: ... cDNA synthesis was performed using the ProtoScript® First Strand cDNA Synthesis Kit (NEB). One microliter of oligo d(T)23VN primer (50 μM ...
-
bioRxiv - Immunology 2024Quote: ... and converted into Illumina sequencing libraries with the NEBNext Small RNA Library kit (NEB). Libraries were sequenced on the Illumina NextSeq-550 in the Boston University Microarray and Sequencing Core ...
-
bioRxiv - Immunology 2024Quote: ... Gibson assembly was performed using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). 100 ng/μl of pET770 was co-injected along with a body wall muscle co-injection marker (17 ng/μl ...
-
bioRxiv - Microbiology 2024Quote: ... the linear plasmid was blunted by digestion with Quick Blunting™ Kit (NEB, USA) and ligated to re-circularize the plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... First-strand cDNA was synthesized using ProtoScript II first strand cDNA synthesis kit (NEB), and quantitative real-time PCR was performed on QuantStudio 3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... All amplified fragments were then combined using Gibson assembly (Gibson assembly cloning kit, NEB) with 20 base pair overhangs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA was extracted first using a Monarch® Total RNA Miniprep Kit (NEB T2010) with on-column DNAse digestion ...
-
bioRxiv - Microbiology 2024Quote: Deletion of vpr was achieved using Q5 Site-Directed Mutagenesis kit (New England Biolabs) where the majority of the vpr coding sequence was deleted using PCR exclusion (forward - CAGAATTGGGTGTCGACATAG ...
-
bioRxiv - Bioengineering 2023Quote: ... using the Monarch Genomic DNA Purification Kit following the manufacturer’s protocol (New England Biolabs). The targeted region in NEAT1 was amplified by PCR (primers in Extended Data Table 2) ...
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Synthetic Biology 2023Quote: ... After gel extraction using the Monarch DNA Gel Extraction Kit (New England Biolabs, T1020S) Gibson Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II Library Prep Kit for Illumina (NEB) and paired-end sequencing was performed using an Illumina Novaseq instrument.
-
bioRxiv - Cell Biology 2023Quote: ... RNAs were selected using the NEB Next Poly A+ Isolation Kit (NEB #E7490S/L). Poly A+ fractions were eluted ...
-
bioRxiv - Cell Biology 2023Quote: ... using the Gibson Assembly Cloning Kit as instructed by the manufacturer (New England BioLabs). The resulting vector was termed pCEP4-MFAP4 coding for the amino acid sequence M1KAL…IRRA255 ...
-
bioRxiv - Cell Biology 2023Quote: ... libraries were prepared using NEBNext Ultra kit (New England Biolabs #E7490, #E7770, #E7335, #E7500) and sequenced using a Nextseq500/550 sequencer ...
-
bioRxiv - Genetics 2023Quote: Sequencing library was constructed by NEBNext ultra II DNA library prep kit (NEB E7103L). 50 million paired-end 50bp reads were obtained for each ChIP and input sample using a NextSeq 2000 instrument ...
-
bioRxiv - Genetics 2023Quote: ... and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs). After mutagenesis ...
-
bioRxiv - Genetics 2023Quote: ... We performed cDNA synthesis from RNA using LunaScript RT Supermix Kit (New England Biolabs) beginning with 500ng of RNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Kit for Illumina (NEB) and sequenced with an Illumina Novaseq 6000 system to produce 50 bp paired-end reads ...
-
bioRxiv - Genetics 2023Quote: ... digested DNA was converted using New England Biolabs’ Enzymatic Methyl-seq Kit (E7120S, NEB) to detect selectively oxidized unmethylated cytosines ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used the NEBNext® UltraTM FS II Library Prep kit (New England Biolabs) with default parameters ...
-
bioRxiv - Genomics 2023Quote: ... We used the NEB Next Enzymatic Methyl-seq Kit (New England Biolabs Cat.no. E7120S). Control DNA (CpG methylated pUC19 and unmethylated lambda ...
-
bioRxiv - Genomics 2023Quote: ... The homology vector was cloned by Gibson assembly (Gibson Assembly Master Mix kit, NEB) into a restriction-enzyme digested pCAG backbone plasmid ...
-
bioRxiv - Microbiology 2023Quote: PCR products were routinely purified using Monarch® PCR & DNA clean-up kit (NEB), or E.Z.N.A.® Cycle Pure Kit (Omega Bio-Tek ...
-
bioRxiv - Genomics 2023Quote: ... followed by NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 (NEB# E6440) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were quantified using NEBNext® kit for Illumina® (New England Biolabs, E7630S), pooled at equimolar amounts ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting RNA was purified using the Monarch RNA cleanup kit (New England Biolabs) and analyzed by agarose gel electrophoresis.