Labshake search
Citations for New England Biolabs :
3401 - 3450 of 4230 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... the oligo pool for each library was amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The resulting plasmid will be referred to as pBd-phoD-HA-BSD.
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621). The homology and guide RNA were inserted as described for pBdEF-Cas9-BSD-phodR ...
-
bioRxiv - Genomics 2023Quote: ... with the inserts at 2 fold molar excess followed by multiple transformations into NEB stable competent E.Coli (NEB) to ensure at least 20x coverage of colonies for every sgRNA ...
-
bioRxiv - Genomics 2023Quote: ... Approximately 7,500 cells were diluted with 1.25 ml of a dilution buffer containing 0.4x NEBuffer 2 (NEB, B7002S), 2 mg/ml BSA (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM NaCl, 2 mM EDTA, 1% NP40, 0.1%SDS, 0.5 mM DTT, 40 U RNase inhibitor [New England Biolabs, cat#M0314L] ...
-
bioRxiv - Molecular Biology 2023Quote: ... To a 10 μL aliquot of the supernatant were then added 2 μL of loading dye (NEB, #B7021S) and 1 μL of 2% sodium N-dodecanoylsarcosinate ...
-
bioRxiv - Bioengineering 2024Quote: ... DNA fragments encoding CDRs 1 and 2 were digested overnight with BsaI-HFv2 and BbsI-HFv2 respectively (NEB). Reactions were cleaned up with Macherey Nagel Gel cleanup columns ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL of each reaction was combined with 2 µL of 6X Purple Gel Loading Dye (NEB B7024S) and 11 µL H2O and run on a 1.2% agarose gel containing 1X GelGreen Nucleic Acid Stain (Biotium 41005 ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant solution was incubated for at least 2□h with amylose-affinity chromatography resin (New England Biolabs), whilst gently shaking at 4□°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The reaction was incubated at 37°C overnight and stopped by adding 2 Units of DNase I (NEB) and incubating at 37°C for 15 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 ng of total RNA was mixed with 2 µL of random primer mix (New England Biolabs, UK) in RNase free PCR strips (Thermo Fisher ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl of methylation-sensitive restriction enzyme DpnI and 2 μl CutSmart® buffer (both from NEB inc.) were added to the assembled reaction and incubated at 37 °C for 30 min ...
-
bioRxiv - Bioengineering 2023Quote: All qPCR reactions were set up using 7.5 µl of 2 x Luna Universal qPCR master mix (NEB), 0.375 pmol forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then digested by adding 2μL LysC (500ng/μL, Pierce) for 2 hours then 6μL trypsin (100ng/μL New England Biolabs) overnight ...
-
bioRxiv - Cancer Biology 2023Quote: We then set up the digestion reaction (1.5 μg of pX459, 2 μL of 10X NEBuffer 2.1, 1 μL of BbsI (NEB), and added H2O to a final volume of 20 μL) ...
-
bioRxiv - Physiology 2023Quote: ... muGFP and homology arms were PCR-amplified using Q5 High-Fidelity 2× Master Mix (New England BioLabs, M0492L). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Cell Biology 2023Quote: ... beads were equilibrated in 1x PMP buffer (50 mM HEPES, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, pH 7.5; New England Biolabs). Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... These two oligos were ligated with splint oligo1 at 37°C for 2 hours using T4 ligase (NEB; 1U/ml T4 DNA ligase and 13 T4 DNA ligation buffer) ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed the SNAP-tag labeling in vivo with 2 μM SNAP-Cell TMR-Star (New England Biolabs) and visualized histones incorporated into chromatin after a pre-extraction of soluble histones before fixation with 2% paraformaldehyde for 20’ as 32 ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: CD52 - Fc fusion protein (20µg) was cleaved with 2 µL of FXa protease (New England Biolabs, Ipswich, USA) in a volume of 350 µL of water containing 2 mM of CaCl2 ...
-
bioRxiv - Microbiology 2024Quote: ... all phages were treated with 2 uL of RNAase A (50,000 U/mL, New England BioLabs, Cat. M02403S) and 50 uL of NEB buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... This PCR was performed in 50µL total volume with 2% DMSO using Phusion polymerase and GC buffer (NEB) with an annealing temperature of 52°C and extension time of 30 seconds ...
-
bioRxiv - Genomics 2024Quote: ... were assembled by Gibson assembly using a 2:1 insert:vector ratio with Gibson Assembly Master Mix (NEB E2611S). Assemblies were transformed into NEB 5-alpha E.coli competent cells and single colonies were picked and sequence validated by Sanger sequencing ...
-
bioRxiv - Immunology 2024Quote: ... Cells were collected and resuspended in 1x glycobuffer-2 along with PNGaseF (100U/106 cells, NEB Cat# P0709S) for 4-8 hrs at 37°C in incubator ...
-
bioRxiv - Synthetic Biology 2024Quote: ... extracted PCR product with 2 μl of NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... were directly added to the beads and incubated at 70 °C for 2 min before 7.8 µl of ligation master mix (0.097% RNA ligase buffer (NEB), 1.94 mM DTT ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared by mixing 25µL of NEBNext High-Fidelity 2× PCR Master mix (M0541, New England Biolabs), 21µL CUT&Tag DNA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... as follows: 20 μL reactions were prepared using 2 μL 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S), nuclease-free water ...
-
bioRxiv - Genomics 2024Quote: ... and 3.2 µl of PCR mix (1.5× Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs), 0.15% Tween-20 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μg of a construct encoding eGFP-nanos3’UTR was digested using NotI-HF (New England BioLabs, R3189S) for 1 h ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...
-
bioRxiv - Plant Biology 2024Quote: ... Genes of interest were cloned to Gateway™ pENTR™ 4 Dual Selection Vector (A10465) by NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621L) and cloned to a pUC19 expression vector powered by the maize ubiquitin promoter (ZmUBI ...
-
bioRxiv - Neuroscience 2024Quote: ... Pellets were resuspended in NEB buffer prior to centrifugation at 11,500 rpm for 20 minutes at 4°C on a sucrose gradient (1.6M sucrose in NEB and 0.8M sucrose in NEB). Nuclei-containing pellets were fixed with 0.3% formaldehyde in NEB and rotated at room temperature for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... R3104L) for SMG6-3xFLAG in reactions containing 40 ng/ μl DNA (4 μg in total) in 1x CutSmart buffer (NEB, Cat No. B7204S) for 2h or overnight at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Genomics 2020Quote: ... Biotin was removed at 20°C for 4 hours in a 50 μL reaction for every 5 μg of DNA using 15 units of T4 DNA polymerase (NEB, M0203L) and 25 nM dATP and 25nM dGTP in NEBuffer 3.1 (no dTTP and dCTP) ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.