Labshake search
Citations for New England Biolabs :
3351 - 3400 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 100 μU ml-1 lambda phosphatase (NEB), and 25 μU ml-1 apyrase (NEB)] ...
-
bioRxiv - Plant Biology 2024Quote: ... cut with 1 unit of BpiI (NEB) at 37 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM ATP (P0756S, New England Biolabs) and 20 units of T4 Polynucleotide kinase (M0201L ...
-
bioRxiv - Molecular Biology 2023Quote: ... Torin at 1 µM (New England Biolabs), and Bafilomcyin at 10 nM (Sigma) ...
-
bioRxiv - Biophysics 2023Quote: ... in NEBuffer 1 (New England Biolabs #B7030) at 30°C for 1 hour followed by column purification ...
-
bioRxiv - Biochemistry 2023Quote: ... 1× Q5 reaction buffer (New England Biolabs), 200 µM dNTPs (Thermo Fisher Scientific ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ... in 1× T4 DNA ligase buffer (NEB). Samples were column-purified using RNA Clean & Concentrator-5 (Zymo Research) ...
-
bioRxiv - Neuroscience 2023Quote: ... in 1:10 CutSmart Buffer (BioLabs #B6004S) at 37°C for 1 hour ...
-
bioRxiv - Genetics 2024Quote: ... and 1× Q5 buffer (New England Biolabs). Thermal cycling was performed as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 µL T4 PNK (NEB, #M0201L) for 30 to 60 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 1× T4 DNA ligase buffer (NEB) for 30 min at 37 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mM ATP (P0756S, New England Biolabs) and 20 units of T4 Polynucleotide kinase (M0201L ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 IU Taq DNA polymerase (NEB). For detection of KPNA2 mRNA a forward primer in exon 1 (5’-GAA GGG TAG CAG ACG TTT CC-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... and T4 RNA Ligase 1 (NEB, #M0204S), respectively ...
-
bioRxiv - Genomics 2024Quote: ... 1 μL T4 DNA ligase (NEB M0202M), 15 μL nuclease-free water ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 unit of Phusion DNA Polymerase (NEB), as well as 10 pg of a pD-template ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 1 volume of λ-Phosphatase (NEB) with 1 volume of water ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 U T4 RNA ligase 1 (NEB), 50 mM Tris-HCl pH=7.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL Dnp1 restriction enzyme (NEB, #R0176S) was added to the PCR mixture and the sample incubated at 37 °C for 1 h ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
bioRxiv - Genomics 2019Quote: ... The embryos were treated with protease (1 µL of 25 µg/µL Qiagen Protease, 1 µL of 10x NEB Buffer 4 ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Bioengineering 2024Quote: ... were mixed in molar ratio 1:1 and 0.37 pmol of total DNA was then treated by Gibson Assembly Master Mix (New England Biolabs) for 3 hours at 50°C ...
-
bioRxiv - Microbiology 2020Quote: ... total RNA was collected and prepared using Monarch Total RNA Miniprep Kits (NEB). For SARS-CoV-2 experiments ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by subcloning into pEAQ-HT vector using the Gibson assembly kit (NEB). Linearization of pEAQ-HT vector was performed by XhoI and AgeI restriction enzyme double digestion ...
-
bioRxiv - Plant Biology 2019Quote: ... The libraries were prepared using the Next Ultra RNA Library Prep Kit (NEB) by the company Novogene (China) ...
-
bioRxiv - Microbiology 2020Quote: ... chloramphenicol or apramycin resistance cassette by using the Gibson isothermal assembly kit (NEB) followed by PCR amplification using the primers from the extremities ...
-
bioRxiv - Microbiology 2020Quote: ... followed by vector-insert ligation using the Quick Ligation kit (New England Biolabs) to generate the original and mutated pCAGGS-HHRz-3M-eGFP-5M vectors ...
-
bioRxiv - Cell Biology 2019Quote: ... rRNA was depleted using the NEBNext rRNA Depletion Kit (E6310, New England Biolabs) and subsequently directional RNA-seq libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (E7420 ...
-
bioRxiv - Immunology 2021Quote: ... The released DNA was cleaned up using Monarch DNA PCR Clean Kit (NEB) and eluted in TE buffer ...
-
bioRxiv - Genetics 2021Quote: SpyCas9 tyr and tbxta sgRNAs were synthesized using EnGen sgRNA Synthesis Kit (NEB). SauCas9 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon was purified using the Monarch PCR and DNA Cleanup Kit (NEB), and 1 ug used as template for transcription of digoxigenin labelled riboprobes using the DIG RNA Labelling mix (Sigma).