Labshake search
Citations for New England Biolabs :
3251 - 3300 of 3806 citations for Recombinant Mouse Scavenger Receptor Class B Member 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: PCR-generated fragments of the CNX1 and CNX2 genomic regions lacking stop codons and including the 1-kbp promoter regions were obtained using Phusion HF DNA polymerase (New England Biolabs), inserted into pENTR-2B ...
-
bioRxiv - Immunology 2022Quote: ... the pools of insert 1 and the pools of insert 2 were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB). The assembled product was bead-purified using Sera-Mag SpeedBeads (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.5% (vol/vol) Triton X-100 in nuclease-free water and 1% (vol/vol) proteinase K (New England Biolabs, P8107S). The sample was digested in this buffer for ≥36h in a humidified ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pSpy0K6 and p7INT.1 was extracted using the Monarch® HMW DNA Extraction Kit for Tissue (New England Biolabs®) according to the manufacturers protocol for Gram-positive bacteria (low input ...
-
bioRxiv - Microbiology 2024Quote: The ectodomains of the hemagglutinin proteins from selected influenza virus strains were ordered as synthetic DNA fragments from Twist Biosciences and cloned with a barcoded fragment encoding the last 46 amino acids of WSN HA as 3-segment assembly reaction into a construct containing the 3’ non-coding region of the packaging signal and signal peptide from A/WSN/1933 influenza HA and the a Read 1 Illumina sequence and the full 5’ packaging signal from A/WSN/1933 virus using Hifi Assembly Mastermix (NEB). The backbone for this cloning reaction was a pHH21 plasmid (16 ...
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were generated from 1 μg DNA per sample using the NEBNext Ultra DNA Library Prep Kit (NEB #E7645, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Purified digested vector and inserts were ligated in a 1:30 vector/insert ratio using the T4 DNA ligase (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% sodium dodecyl sulfate) and reverse crosslinked with proteinase K overnight at 65C and subsequently treated with RNAse A (NEB) for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 1 µL of nuclease P1 (100,000 U/mL) (New England Biolabs, Fig. 2f and Extended Data Fig. 2c,d) were treated with 1.5 of 10× TURBO DNase buffer or nuclease P1 buffer in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Neuroscience 2024Quote: ... DIG- and FITC-labeled antisense RNA probes were generated from 1 µg of linearized plasmid template using T7 or Sp6 RNA polymerases (NEB) and DIG-11-UTP (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of the DNAse digestion product was then treated with 1 μL of Proteinase K (New England Biolabs, P8107S) in UltraPure water for a total reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2024Quote: ... The linearized vector and PCR-amplified sequences were mixed at a 1:2 molar ratio and assembled using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... To do this 2.5 uL of cutsmart buffer was added to 20 uL of purified PCR product and then 1 uL of DpnI (NEB) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA/sgRNA/Cas9 ratios of 1/10/10 were used in a 10 µl reaction using the buffer supplied (NEB) and DEPC-treated water (Haussmann et al ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... The slides were washed three times with 1× PBS and incubated with or without 60 U/mL RNase H (M0297S, NEB) at 37°C for 36 h or left untreated ...
-
bioRxiv - Microbiology 2024Quote: ... The HIV-1AC-1 mutations were introduced into WT and N74D pNLdE-luc using the Gibson Assembly Cloning kit (New England Biolabs) and primers shown in Table S1 ...
-
bioRxiv - Microbiology 2024Quote: ... an inverse PCR was performed using R3-p21 and the oligonucleotides ToANV-rectest-For/ToANV-rectest-Rev (Supplementary Table 1) using Phusion High-Fidelity DNA Polymerase (New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of total RNA was used for standard library preparation using NEBNext PolyA mRNA magnetic isolation module (NEB, E7490). In brief ...
-
bioRxiv - Immunology 2024Quote: ... To subclone this pool we digested our protospacer-empty Libr.1-null transfer vector with BsmBI-v2 (New England Biolabs, NEB) overnight at 55 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Microbiology 2023Quote: The eluted gDNA was resuspended by pipetting to make the beads and elution as homogenous as possible before 20 µL was used in a 40 µL digest using 1 µL of nucleoside digestion mix and 4 µL 10X buffer following the protocol for Nucleoside Digestion Mix (NEB) in an unskirted PCR plate ...
-
bioRxiv - Microbiology 2024Quote: ... and used as a template for barcode amplification in a 1-step PCR with Q5 polymerase with high-GC buffer (NEB). Indexed samples were sequenced on a NextSeq 550 in high-output mode (Donnelly Centre ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Cell Biology 2024Quote: THP-1 monocytes were harvested and lysed for RNA extraction using the Monarch Total RNA Miniprep kit (New England Biolabs), according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... a five-fold molar excess of oligonucleotides bearing either 8-oxo-G or G was mixed with the phage-extracted circular single-stranded DNA in 1=×=Phusion HF Buffer (New England BioLabs). After denaturation at 90=°C for 2=min followed by rapid cooling ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 3’ adapters with 5’-adenylated RNA adapter (see 3’ adapters in table below) were ligated to the recovered small RNAs using Rnl2(1-249)K227Q RNA ligase (M0351, New England Biolabs) according to the manufacturer’s instructions at 4°C overnight with shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... the KCNJ16 gene was amplified with 1× Q5 Hot Start High-Fidelity master mix (New England Biolabs, Ipswich, United Kingdom), 0.5 μM forward primer (‘5-‘3 CTACCCGCCAGAGCACATTAT ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...
-
bioRxiv - Developmental Biology 2024Quote: ... Probes were hybridised in FISH hybridization buffer (50% formamide, 20% dextran sulfate, 2X SSC, 1 μg/μL BSA (New England Biolabs), 10 mM vanadyl-ribonucleoside complex ...
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs). The genomic region surrounding the spo11uc73allele was amplified for 35 cycles with an annealing temperature of 57°C and products were resolved without digestion48 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL resuspended plaque were used for each PCR in 10 µL scale in the presence of 1 x High Fidelity PCR Master Mix (NEB) and 500 nM NudE.1 fwd and rev screening primer (Supplementary Table 2 ...
-
bioRxiv - Biochemistry 2023Quote: ... 30 ng pT-plasmid either carrying the blasticidin or the puromycin resistance marker and 1 unit HIFI Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer (05917131103 ...
-
bioRxiv - Biochemistry 2023Quote: ... or targeting a specific sequence within the puromycin resistant cassette (P3 Supplementary Table 2) were mixed with 1 unit HiFi Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer with MgCl2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... gondii total RNA was ligated to a small RNA oligo (Rumsh, see Table S9) using T4 RNA Ligase 1 (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Illumina adapters were ligated on at the 3′ end of the complementary strand using 1× TA Ligase Master Mix (NEB). All products were indexed and sequenced on an Illumina MiSeq instrument ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... before ligation to microsatellite expansion adapters containing an EcoRV restriction site (listed in Supplemental Table 1) using the T4 DNA Ligase Kit (NEB) at a 5:1 ratio overnight at 16°C ...
-
bioRxiv - Microbiology 2023Quote: ... For the restriction digest 1 µg of genomic DNA from UACa20 and als4112Δ was incubated for 1 hour at 37 °C with the restriction endonuclease BamHI-HF (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were run on a 1% agarose gel and DNA was extracted using Monarch DNA Gel Extraction Kit (New England Biolabs). DNA was sequenced by Sanger sequencing using either the forward or reverse primer ...
-
bioRxiv - Genomics 2023Quote: ... The washed pellet was resuspended in TM2 buffer with 1 mM CaCl2 and 12000 U of MNase (New England Biolabs), incubated at 23°C for 15 minutes and the reactions stopped by addition of 0.5 mM EGTA ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... An insert downstream of aga2 was amplified from pYD2 using primers PK463+PK464 in a 1 ml PCR reaction (Q5 High-Fidelity 2X Master Mix, NEB), DpnI digested for 2 h and SPRI purified ...
-
bioRxiv - Molecular Biology 2023Quote: ... Harvested cells were rinsed with ice-cold PBS and resuspended in lysis buffer with 1% Triton X-100 and 40 U/mL murine (New England Biolabs) for 20 minutes with intermittent tapping on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10ng of purified BbsI linearized UniSAM or BsmBI linearized pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP was ligated with 1 μl of diluted annealed gRNA with 0.5 μl of T4 ligase (New England Biolabs, #M0202L) in a total volume of 10 μl ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as template for the 2nd PCR where Illumina barcodes were added by NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1 and 2) (New England Biolabs). PCR products were purified using AMPure XP beads (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of cDNA was used in a 50 μl PCR reaction containing 1 μl of 10 μM PCR primer and 25 μl of 2x LongAmp Taq Master mix (NEB). PCR was performed as shown in Supplementary Protocol ...
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...