Labshake search
Citations for New England Biolabs :
3251 - 3300 of 5892 citations for 6 Methylimidazo 1 2 a pyridine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: Library oligos for the prime editing screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB M0541L) with the forward primer GTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTT and the reverse primer CTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGGTGTTAGG ...
-
bioRxiv - Biophysics 2023Quote: ... These plasmids were digested with NotI-HF and XhoI for 2 h at 37°C (R3189, R0146, New England Biolabs, UK) and heat-inactivated for 20 min at 80°C.
-
bioRxiv - Genomics 2023Quote: ... thirty 20 μl ePCRs were performed using 400 ng of DNA for each reaction and NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541S) with the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The mutant and wild-type target RNA were subsequently amplified using either the NEB Luna SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB E3019), Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB M3019 ...
-
bioRxiv - Cell Biology 2022Quote: ... The mutant fragments were amplified by high-fidelity DNA polymerase 2 × Phanta Max Master Mix followed by DpnI (New England BioLabs; R0176S) digestion in 37°C for 1 hour to eliminate the templates ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were analyzed on 2% Agarose gels with 0.5 ng/L Ethidium bromide using a 1kb Plus DNA Ladder (New England BioLabs Cat # N3200S) for size reference ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... All mRNAs were transcribed at 30°C for 2 hrs using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040S) and were co-transcriptionally capped (8:1 cap analog to GTP for ∼90% capping efficiency ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to linearize plasmid (10 µg) by incubating at 37 °C for a minimum of 2 hours in 1x CutSmart buffer (NEB, B7204S). Linearized plasmid was purified by extraction with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were created using 1000ng of total RNA with the NEBNext Ultra 2 Directional RNA Library Kit following the Poly(A) mRNA Magnetic Isolation module (NEB #E7490). Libraries were sent to Novogene for Illumina Hi-Seq ...
-
bioRxiv - Developmental Biology 2023Quote: ... The 2-kpb cbln12 promoter (Dohaku et al., 2019) and lTl-Kaede-pAS were subcloned to pT2ALR-Dest by NEBuilder (NEB, USA). To generate Tg(5xUAS-hsp70l:HA-skor2-P2A-mCherry ...
-
bioRxiv - Plant Biology 2023Quote: ... and PEP444c were amplified using a cDNA template obtained from 2-week-old barley shoots and roots and Q5® High-Fidelity DNA Polymerase (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNAs were diluted 1:10 and 2 μl of each used for subsequent PCR reactions with one unit of Taq polymerase (New England Biolabs, MA), 200uM dNTPs (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: Library oligos for the MYC enhancer screen were synthesized by Twist Bioscience and amplified using the NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), forward primer ...
-
bioRxiv - Genetics 2023Quote: ... were carried out with 3 nM of each DNA fragment from the master mix and 2 µL of the NEBridge Golden Gate Assembly Kit (BsaI-HFv2) (NEB E1601S) in 1X T4 DNA ligase Reaction Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification of target genes was carried out using a SYBR Green based qPCR mix consisting of Q5® High-Fidelity 2× Master Mix (NEB), SYBR Green ...
-
bioRxiv - Genomics 2023Quote: ... The gDNA is eluted with 25.2uL ddH2O and undergoes a second round of in vitro CpG methylation with previously described parameters above with exception that 10x Mg2+-free buffer is replaced with equal volume of NEB Buffer #2 (New England Biolabs, B7002S). The reaction is incubated again for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions were performed at 37°C for the indicated time (30 min if not otherwise specified) and then terminated by the addition of 10 μL of 2× RNA loading dye (New England Biolabs, USA). Reaction samples were heated at 85°C for 2 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ with different conjugated molecules and BAD variants conjugated with mCitrine were subcloned to the multiple cloning site (MCS-2) using EcoRI and XbaI (NEB; # R0145S) and the MCS-1 using MluI-HF (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the targeted DNA region was amplified by PCR using the biomass as the template with the Q5™ High-Fidelity 2× master mix (New England Biolabs). Base-editing efficiency when targeting a plasmid-borne gene was estimated by isolating plasmid DNA upon 24-h editing treatment by using the NucleoSpin™ plasmid EasyPure kit (Macherey-Nagel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos for side 1 and 2 were dimerized separately by mixing 9 μl of OligoA at 100 μM with 9 μl of OligoB at 100 μM and 2 μl of 10x DNA Ligase Buffer (NEB, M0202S) and heating to 95 °C for 5 minutes ...
-
bioRxiv - Zoology 2024Quote: ... The annealed dsRNAs (2.5 µg) were checked on 1.5% agarose gel by running them together with 2 µL of dsRNA ladder (NEB# N0363S, Germany) (Fig ...
-
bioRxiv - Cell Biology 2024Quote: RNA encoding indicated HSP90B1 nascent chains were prepared from PCR amplified and purified DNA template containing a T7 promoter and carried out at 37°C for 2 hours using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs) and purified using the RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2024Quote: Transcription templates for expressing gRNA variants and SARS-CoV-2 or CMV input RNA fragments were generated by PCR (Phusion high-fidelity PCR kit, NEB #E0553) of the gBlock or Ultramer template that included a T7 promoter and the gRNA or input RNA coding sequence ...
-
bioRxiv - Genetics 2024Quote: ... 250 ng of RNA samples were digested at 37°C for 2 hours with Nucleoside Digestion Mix (New England Biolabs, M069S). Digested RNA samples were diluted to 100 µl with double-distilled water and filtered through 0.22 µm Millex Syringe Filters ...
-
bioRxiv - Genomics 2024Quote: ... The reaction was purified using the Zymo DNA Clean & Concentrator kit and PCR-amplified with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and primers as defined in Corces et al ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ddRAD library preparation included an initial digestion of 300 ng of DNA in a 34 μL reaction (2 hours at 37 °C; 10 U each of SbfI and MspI, New England Biolabs Inc.). Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Standard Illumina adapters were ligated using 60 cycles of digestion at 37 °C (2 minutes) and ligation at 16 °C (4 minutes) with 400 U of T4 ligase (New England Biolabs, USA), followed by heat-inactivation at 65 °C (10 minutes) ...
-
bioRxiv - Neuroscience 2024Quote: ... Final nuclear lysates were resuspended using 100 µl of resuspension solution (1x PBS, 2% BSA, 0.2U/µl RNase inhibitor; New England Biolabs, cat# M0314S). Hoechst staining was performed to assess the quality of isolated nuclei based on their morphology ...
-
bioRxiv - Neuroscience 2024Quote: ... and Gas5 shRNAs (shRNA # 1= G5C1 and shRNA # 2= G5C2) were cloned by replacing the existing Luciferase shRNA (shRLuc) under a U6 promoter using BamHI (NEB #R0136L) and EcoRI restriction sites (Table 3) ...
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed and phosphorylated sgRNA (1:10) and T4 Ligase reaction buffer (1:10, #B0202S, New England Biolabs) with 10 mM 10x Adenosine 5’-Triphosphate (#P0756S ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 µl of 1 mM BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 µl of axonemes ...
-
Efficient CRISPR/Cas9 genome editing in a salmonid fish cell line using a lentivirus delivery systembioRxiv - Genetics 2019Quote: ... 1 µL of each oligo (100 µM) were mixed with 1 µL of T4 ligation buffer (NEB) and 7 µL of water ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proximity ligation was done under the following conditions: 1 unit/µl RNA ligase 1 (New England Biolabs), 1x RNA ligase buffer ...
-
bioRxiv - Genomics 2022Quote: ... and the PCR products were analyzed in 1% agarose with 1 kb DNA Ladder (New England Biolabs). Primers used in this study are shown in Supplemental Table S1.
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg of each pFRT-TO-CLIP-UPF1 mutant vector was digested with 1 µL SpeI (NEB) and 1 µL HindIII-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µl of 1 mM BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 µl of axonemes ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mM EDTA pH 8.0 (Roth) and 1:100 Proteinase K (New England Biolabs 20 mg/ml)) in a 2 ml Eppendorf tube for at least 24 hours at RT in the dark ...
-
bioRxiv - Microbiology 2023Quote: ... A 1 ml aliquot of each phage was treated with 1 µl DNase (New England Biolabs, USA) at 37 ⁰C for 40 minutes ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Physiology 2020Quote: ... pNP152 was obtained by insertion of the sta-2 promoter and sta-2 gene fused to Lifeact::mKate2 [75] into the MosSCI vector pCFJ151 [76] using Gibson Assembly (NEB Inc., MA) and confirmed by PCR or sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... The probes were prepared by end labelling 10 pmoles of DNA oligonucleotide complementary to the sfRNA (Supplementary Table 2) with [γ-32P]-ATP (Perkin-Elmer, USA) using T4 polynucleotide kinase (NEB, USA) and purified from unincorporated nucleotides by gel filtration on Illustra MicroSpin G-25 Columns (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... nigrum young leaf and peduncle cDNA using c70979_Fw and c70979_Rv primer and cloned into the pEAQ-HT vector(50) using NruI-HF and SmaI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The relinearized single-stranded DNA template was subjected to PCR amplification by using barcoded primers for Illumina TrueSeq small RNA sample and Phusion High-Fidelity DNA Polymerase (2 U; M0530L, NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNAs were subcloned into vectors through conventional ligation with Ligation high Ver.2 (Toyobo, Osaka, Japan) or NEBuilder HiFi DNA Assembly (New England Biolabs, Ipswich, MA) according to the manufacturers’ instruction ...
-
bioRxiv - Cell Biology 2020Quote: A total of 1 μg of RNA was used for cDNA library construction at Novogene using an NEBNext Ultra 2 RNA Library Prep Kit for Illumina (New England Biolabs; Cat.# E7775) as per the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Single primer PCR was performed in 2 different tubes for each plasmid using Q5 2X Master Mix (New England Biolabs Cat.No M0492S). After the amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... µM GAT-7N primers (5′- GTG AGT GAT GGT TGA GGT AGT GTG GAG NNN NNN N) and 2 units/µl DeepVent® (exo-) DNA polymerase (New England Biolabs, M0259L) in the programmable thermal cycler for 11 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... The construct was amplified by 2-step PCR according to manufacturer recommendations using Q5 high fidelity polymerase (New England Biolabs, cat#M0494S) with primers 6469TSC and 6470TSC (Supplemental table 1) ...