Labshake search
Citations for New England Biolabs :
3201 - 3250 of 4067 citations for SARS CoV 2 Spike Glycoprotein S2 aa 1000 1200 His Tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Each PCR#2 reaction contained 25 µL of Q5 High-Fidelity 2X Master Mix (NEB), 2.5 µL of a unique Nuc PCR#2 Fwd Primer (10 µM) ...
-
bioRxiv - Immunology 2022Quote: PCRs were done with the Q5 Hot-start 2× master mix (New England BioLabs, NEB), and cloning was performed using the Gibson Assembly 2× Master Mix (NEB ...
-
bioRxiv - Immunology 2022Quote: PCRs were done with the Q5 Hot-start 2× master mix (New England BioLabs, NEB), and cloning was performed using the Gibson Assembly 2× Master Mix (NEB ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Bioengineering 2019Quote: ... LAMP mix contained 10 µL 2×WarmStart LAMP Mastermix (New England Biolabs, Ipswich, MA, USA) and 6 µL water ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs, USA) at 65 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... The sample was chilled to halt the denaturation process and GlycoBuffer 2 (New England Biolabs), NP-40 ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 ug of DNA was treated with uracil DNA glycosylase (UDG, New England Biolabs, Inc.) for 60 minutes at 37°C with gentle shaking ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2 (NEB E7335S & E7500S). In order to increase input DNA above single library limits (1 μg ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplicons encompassing exon 2 of SERINC3 were produced using Taq 2x Master Mix (NEB) and the following primers ...
-
bioRxiv - Bioengineering 2024Quote: ... 2) parts were either synthesized as fragments (Twist Bioscience) and subsequently PCRed using Q5 (NEB), or synthesized as duplex oligos (IDT) ...
-
bioRxiv - Cell Biology 2024Quote: ... RNF43 mutants were generated by PCR-subcloning using Q5 High-Fidelity 2× Master Mix (NEB). Domain swapped constructs were generated by in-fusion cloning (Takara Bio) ...
-
bioRxiv - Immunology 2024Quote: ... Purified round 2 PCR products were cloned using the NEB PCR Cloning Kit (NEB, #E1202) and sequenced with Sanger sequencing.
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Samples were cooled to 42 °C and 2 μl of β-agarase I enzyme (NEB) was added and incubated at 42 °C for 90 min with occasional vortexing ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA (2 µg) was first annealed with 200 ng random nonamer primers (NEB S1254S) by incubation at 70°C for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The cutting vector GW223_pX330A_sgX_sgPITCh (2 μg) was digested with BbsI-HF (New England Biolabs; #R3539) in Cutsmart Buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... For AsiSI digestion, samples were equilibrated (2 min, RT) in 150 µL CutSmart buffer (NEB). 3µl recombinant AsiSI endonuclease (10U/µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of each ATAC-seq library was added to 2x NEBNext Master Mix (NEB) and 0.4x SYBR Green (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR reactions were performed by combining 12.5 µL Q5 high-fidelity 2× master mix (NEB), 2.5 µL each of 10 µM forward and reverse primers ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of gRNA was mixed with 3.3 μL of Spy Cas9 NLS (NEB, UK) and incubated for 30 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... After digestion the linearized backbone was dephosphorylated by addition of 2 µl rSAP (NEB, #M0371S) and incubation at 37 °C for 1 hour followed by heat inactivation of the enzymes at 80 °C for 20 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... 2) the CYC terminator by digesting pDL00212 with HindIII-HF (New England Biolabs, Ipswitch, MA) and SpeI-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 1-2 µg phi47 DNA was treated with Nucleoside Digestion Mix (New England Biolabs) following the manufacturer’s protocol at 37°C for >2h ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µg of DNA was treated with uracil DNA glycosylase (UDG, New England Biolabs, Inc.) for 60 minutes at 37°C with gentle shaking ...
-
bioRxiv - Microbiology 2024Quote: ... 9.5 µL of tRNA was combined with 2 U/µL of T4 PNK (NEB, M0201S) was well as N-terminally His6-TEV-tagged ATfaRel SAH (final concentration 1 µM ...
-
bioRxiv - Developmental Biology 2024Quote: 2 μg of genomic DNA was digested with 100 units of Taq1-v2 (NEB R0149S) and 100 μg of RNaseA overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... A total of 1000 ng of RNA was utilized for library preparation with the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2019Quote: ... the HeLa cells were kept in HeLa culture media treated overnight with 0.2 U/mL of □2-3,6,8,9 Neuraminidase (New England Biolabs) to cleave sialic acid from the cell surface glycans.
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...
-
bioRxiv - Genomics 2020Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added to the aRNA/adapter solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Molecular Biology 2019Quote: ... in the presence of Quick Ligase enzyme and 2× Quick Ligase Reaction buffer (New England BioLabs). Before transfer to the yeast ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment(anti-sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cancer Biology 2019Quote: ... was ligated to the RNA fragments on bead using T4 RNA ligase 2 truncated KQ (NEB M0373 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µl of PCR product was then mixed with 1.5 µl 10X NEBuffer 2 (B7002S, NEB) and 1.5 µl of Nuclease-free water ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Plant Biology 2021Quote: ... using BamHI and XhoI restriction sites and 2× Gibson Assembly master mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...