Labshake search
Citations for New England Biolabs :
3201 - 3250 of 10000+ citations for Mouse Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... We then transcribed each sgRNA in vitro using the HiScribe T7 Kit (NEB, E2040S) with 37°C incubation for 6 hours before treating with DNase at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2020Quote: ... first by chloroform extraction and ethanol precipitation followed by Monarch RNA cleanup kit (NEB).
-
bioRxiv - Bioengineering 2021Quote: ... cDNA was then synthesized using the Protoscript II First Strand cDNA synthesis Kit (NEB). 1 μl of cDNA was amplified by PCR with primers that amplify about 300-600 bp surrounding the sites of interest (outside the length of the antisense domain ...
-
bioRxiv - Bioengineering 2020Quote: ... Amplified DNA was cleaned up with the Monarch DNA Gel Extraction Kit (NEB, T1020S) and samples were submitted to Genewiz for standard Sanger sequencing analysis ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutations in FLYC1 were introduced using Q5 site-directed mutagenesis kit (New England Biolabs).
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing libraries were generated using NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2021Quote: ... synthesized mVenus fragments were assembled using HiFi Infusion Kit (New England Biolabs, Ipswich, MA) into linearized pUC19 vector (Takara Bio USA ...
-
bioRxiv - Bioengineering 2021Quote: ... was synthesized using the HiScribe T7 ARCA mRNA kit (New England Biolabs, Ipswich, MA) and a linearized double-stranded DNA (Supplementary Figure 8) ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was obtained using a ProtoScript II First Strand cDNA Synthesis Kit (NEB, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... which was done with the NEBNext DNA Ultra2 Library Preparation Kit (New England Biolabs). The preparation of the library was performed on an automated liquid handling system (Hamilton Robotics) ...
-
bioRxiv - Systems Biology 2020Quote: ... which was done using the NEBNext Library Quant Kit for Illumina (New England BioLabs) according to the manufacturer’s directions ...
-
bioRxiv - Systems Biology 2020Quote: ... and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760, #E7765)’ ...
-
bioRxiv - Plant Biology 2020Quote: ... total RNA was isolated using the Monarch Total RNA Miniprep Kit (New England Biolabs), and genomic DNA were eliminated by gDNA removal columns and on-column DNaseI-treated (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... These plasmids were generated using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554) instructions based on the previously described codon-optimized pD10-3xFlag according to the manufacturer’s [35] ...
-
bioRxiv - Microbiology 2021Quote: ... Specific gRNA were generated using the Q5 site-directed mutagenesis kit (New England Biolabs) on the pSAG1::Cas9-U6::sgUPRT vector ...
-
bioRxiv - Microbiology 2021Quote: ... RNA purification was done using the Monarch Total RNA Miniprep Kit (New England Biolabs) according to the manufacturer’s manual ...
-
bioRxiv - Genomics 2020Quote: ... The library was prepared using NEBNext® UltraTM RNA library preparation kit (NEB #E7530) following the manufacturer’s instructions and sequenced on the Illumina platform (HiSeq X Ten ...
-
bioRxiv - Genomics 2020Quote: ... and HiScribe™ T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, E2050S), then purified using MEGAclear™ Transcription Clean-Up Kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... in vitro transcribed using HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB) using the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... except that the NEB Next Multiplex Small RNA Library Prep Kit (New England Biolabs) was used for library preparation ...
-
bioRxiv - Microbiology 2020Quote: ... Vpr mutants were generated using site directed mutagenesis (Q5 site directed mutagenesis kit, NEB). pCBASceI was a gift from Maria Jasin (Addgene plasmid # 26477 ...
-
bioRxiv - Molecular Biology 2021Quote: ... All selection samples were ligated to DNA adapters using the Quick Ligation kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... were isolated using the Monarch® Plasmid Miniprep Kit (New England BioLabs Inc., USA), according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... mRNA populations were further purified using the Magnetic mRNA isolation kit (NEB, Ipswich, MA).
-
bioRxiv - Microbiology 2020Quote: ... The RCA products were then purified using the Monarch PCR & DNA Cleanup Kit (NEB), then quantified using the Qubit dsDNA broad range assay ...
-
bioRxiv - Microbiology 2020Quote: ... and then ligated with the y-link adapter using a quick ligase kit (NEB). The ligation product was purified using magnetic beads (Axygen) ...
-
bioRxiv - Microbiology 2019Quote: ... Thermo-Fisher) and simultaneously Gibson assembled (NEBuilder HiFi DNA Assembly kit; New England Biolabs) into the pBAD and pBGC backbones using the primers listed in Table S4 to give rise to pBAD and pBDSM plasmids carrying mutated alleles of the cI-tetA system (Figure S1 and Table S3).
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 3 thermocycler ...
-
bioRxiv - Cancer Biology 2020Quote: ... and NEBNext Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs), following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... and NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the NEBNext Ultra II Directional Library Prep Kit (New England Biolabs, Ipswich, MA). Sequencing was performed on either the NextSeq500 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... using the NEBNEXT Ultra II RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... and double-strand cDNA was synthesized using NEBNext mRNA second strand synthesis kit (NEB). Cleaning was done using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2022Quote: ... The RNA transcripts were purified using the Monarch RNA Cleanup Kit (New England Biolabs). RNA concentrations were determined using Qubit RNA BR Assay Kit (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2022Quote: ... Reaction products were gel purified using the Monarch Gel Purification kit (New England Biolabs) and Sanger sequenced using oligos OFA1204 and OFA1206 to confirm both the sequence of the RPT6 promoter and the synonymous substitutions in the RPT6 ORF ...
-
bioRxiv - Cell Biology 2022Quote: ... Libraries were prepped with the NEB Ultra II stranded mRNA Library prep kit (NEB). RNA-Seq libraries were sequenced with NextSeq ...
-
bioRxiv - Genomics 2022Quote: ... or tail chip using Monarch Genomic DNA Purification Kit (Cat# T3010S, New England Biolabs) and digested by Pst I (Cat# R3140S ...
-
bioRxiv - Molecular Biology 2022Quote: ... the digested DNA fragment and pET28a were ligated using the quick ligation kit (NEB). The resulting construct was selected on LB agar plates supplemented with kanamycin (20 μg/ml ...
-
bioRxiv - Genomics 2022Quote: ... This was modified using the Q5 Site-directed mutagenesis kit (New England Biolabs [NEB]) for domain addition / removal or single amino acid substitutions ...
-
bioRxiv - Genomics 2022Quote: ... This was modified using the Q5 Site-directed mutagenesis kit (New England Biolabs [NEB]) for domain addition / removal or single amino acid substitutions ...
-
bioRxiv - Plant Biology 2022Quote: ... The samples were converted for sequencing with the NEBNext enzymatic methyl-seq kit (NEB) and sequenced at the University of Minnesota Genomics Center ...
-
bioRxiv - Microbiology 2022Quote: ... gDNA-free RNA was purified using Monarch RNA Clean-up Kit (New England Biolabs) and visualised on an agarose gel.
-
bioRxiv - Microbiology 2022Quote: ... and cloned into a pVFT1S expression vector using a HiFi DNA Assembly kit (NEB). Both nsp10 and nsp14 contained an N-terminal 6x-His tag ...
-
bioRxiv - Genomics 2022Quote: ... and poly-A tailed using the HiScribe™ T7 ARCA mRNA Kit (NEB, E2065S) with 50% supplement of 5-Methyl-CTP and Pseudo-UTP (Jena Biosciences) ...
-
bioRxiv - Biochemistry 2022Quote: ... CENP-U250-418) were generated using a HiFi DNA assembly kit (New England Biolabs).
-
bioRxiv - Cancer Biology 2022Quote: ... the library concentration was qPCR measured by NEBNext Library Quant Kit (New England BioLabs) using QuantStudio 5 Real-Time PCR Systems (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: HEV and FCV transcripts were generated using the HiScribe T7 ARCA mRNA kit (NEB) using 1 μg of linearised plasmid template following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... for both RubPro and RubProHel using Q5 Site-directed Mutagenesis Kit (New England BioLabs). The forward and reverse primer used were TCCCAACACTGCGTGGCTGAGAGCCGCCG and TCGAGTTCCCCGCCCCTT respectively ...
-
bioRxiv - Microbiology 2022Quote: ... The fragment was gel purified using Monarch DNA Gel Extraction Kit (New England Biolabs), and Sanger sequencing was performed using BigDye Terminator v3.1 and either the forward or the reverse primer ...