Labshake search
Citations for New England Biolabs :
3201 - 3250 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Illumina NGS libraries were prepared using the NEBNext Ultra II DNA Kit (NEB, E7645S), and sequenced for 50-nt SE reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using the Monarch PCR and DNA Clean Up Kit (#T1030L, NEB), Illumina NGS libraries were prepared using the NEBNext Ultra II DNA Kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using the Monarch PCR and DNA Clean Up Kit (#T1030L, NEB) and ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (E7546S ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Purification of IVT mRNA was conducted using the Monarch RNA Cleanup Kit (NEB #T2040L). To confirm IVT mRNA were of the correct lengths ...
-
bioRxiv - Neuroscience 2023Quote: ... the DNA was extracted by using Monarch® Genomic DNA Purification Kit (NEB, T3010S). For the analysis of microdeletions of the targeted exons an Out-Fwd (p1 GCACAGTCAGACCACAGTCACC ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using either Monarch Total RNA Miniprep Kit (New England Biolabs) or Direct-zol™ RNA MiniPrep kit (Zymo Research ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7490S and #E7760S) was used to construct sequencing libraries following the manufacturer’s guidelines with one alteration ...
-
A laboratory framework for ongoing optimisation of amplification based genomic surveillance programsbioRxiv - Genomics 2023Quote: ... cDNA was generated for all samples using LunaScript RT SuperMix Kit (New England BioLabs). Sufficient volume was prepared to perform serial dilutions (10−2 to 10 -7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were inserted into this vector using the Gibson Assembly Cloning Kit (New England BioLabs). The final constructs were linearized using the KpnI restriction enzyme (Promega ...
-
bioRxiv - Genetics 2023Quote: ... Cloning was conducted using the NEBuilder HiFi DNA Assembly cloning kit (NEB, no. E5520S) and transformed to DH5α-competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... ChIP libraries were prepared by NEBNext ultra II DNA library preparation kit (NEB E7645L) and sequenced on one lane of a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: Cells were lysed and RNA extracted using the Monarch Total RNA Miniprep Kit (NEB) or RNA cleanup kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: Coupled transcription-translation assays were carried out with the PURExpress kit (New England BioLabs) as described in (Lukasiewicz and Contreras ...
-
bioRxiv - Genomics 2023Quote: ... sgRNA was synthesized using NEB’s HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). For generation of transgenic fish ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The DNA/RNA hybrid strand was pre-adenylated with DNA 5’ Adenylation Kit (NEB) and purified with Oligo Clean & Concentrator (Zymo) ...
-
bioRxiv - Cell Biology 2023Quote: ... The NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina® (NEB, USA) was used to generate the sequencing library ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were generated using NEB Next Ultra DNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs), following manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Assays were set-up using PURExpress in vitro protein synthesis kit (New England Biolabs) with a cloned full-length DHFR template ...
-
bioRxiv - Genomics 2023Quote: ... and ligation of NEBNext adaptors (NEBNext Multiplex Oligos for Illumina kit, New England BioLabs). Libraries were digested using the USER enzyme (New England BioLabs) ...
-
bioRxiv - Microbiology 2023Quote: ... Pulldown RNA was ribominus selected using the NEBNext rRNA Depletion Kit v2 (NEB # E7400L) and RNA-Seq libraries were generated using the NEBNext® Ultra II Directional RNA Library Prep Kit (NEB # E7760L) ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragments were joined together using Gibson assembly kit (NEB Cat. No. E2611L) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Metagenomic libraries were prepared using the NEB Ultra II kit (NEB; Cat. No. E7645L) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA (>300 ng) was reverse transcribed using the Lunascript RT Supermix Kit (NEB, E3010).
-
bioRxiv - Cancer Biology 2024Quote: ... RNA libraries were prepared using NEB UltraII RNA library Prep kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then immediately followed by Library prep using NEBNext Ultra II kit (NEB, E7770). Libraries were pooled and sequenced using a H75 kit from Illumina in a NextSeq500 sequencer following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... A NEBNext® Single Cell/Low Input RNA Library Prep Kit (New England Biolabs) was used for library generation ...
-
bioRxiv - Neuroscience 2022Quote: ... and mPer2W419E (Fig S2) were generated using Q5 Site-Directed Mutagenesis Kit (NEB E0554S). pcDNA-mPer1and mPer2 plasmids were used as templates and have been described previously37 ...
-
bioRxiv - Molecular Biology 2022Quote: ... using either the Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA, United States) or in-Fusion Cloning Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by cleaning up with Monarch PCR & DNA Cleanup Kit (T1030, New England Biolabs). The ligated DNA was repaired with PreCR Repair Mix (M0309 ...
-
bioRxiv - Plant Biology 2022Quote: ... using NEBuilder® HiFi DNA Assembly Cloning kit (New England Biolabs, Ipswich, MA, USA). For LTPG1 and LTPG2 ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product obtained were purified using the Monarch DNA Gel Extraction Kit (NEB) and cloned into the pDONR207 using a BP Clonase II Kit (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: m6A RNA-IP enrichment was performed using kit manufacturer protocol (New England BioLabs, #E1610S). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... treated with phenol-free RNA Binding Buffer (included in RNA Cleanup Kits from NEB) and Proteinase K ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse transcribed using the ProtoScript® First Strand cDNA Synthesis Kit (NEB, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Pulldown RNA was ribominus selected using the NEBNext rRNA Depletion Kit v2 (NEB # E7400L) and RNA-Seq libraries were generated using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB # E7760L) ...
-
bioRxiv - Microbiology 2022Quote: ... total RNA was isolated using the Monarch Total RNA Miniprep Kit (New England Biolabs) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted using Monarch® Genomic DNA purification kit (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mutations were generated by following the Q5 site-directed mutagenesis kit protocol (NEB E0554) with Q5 Hot-Start High-Fidelity Master Mix ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated from individual colonies (Monarch Plasmid Miniprep Kit, New England Biolabs, #T1010L) and sequenced (Mix2Seq Kit NightXpress ...
-
bioRxiv - Microbiology 2022Quote: ... coli host strain using the Monarch® Plasmid Miniprep Kit (NEB, Ipswich, MA, USA). The extracted plasmid was linearized with restriction enzyme BamHI (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... We cloned each fragment into pMiniT using the PCR Cloning Kit (New England BioLabs), following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Total RNA was then isolated using Monarch Total RNA Miniprep Kit (New England Biolabs). cDNA was synthesised from 350 ng of total RNA from each sample using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... mRNA libraries were prepared with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) and size selection for libraries was performed using AMPure XP system (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The transcripts were purified using the Monarch® RNA Cleanup Kit (50 μg) (NEB) and verified on a 6% PAA ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: ... rRNA was removed from the total RNA using a NEBNext rRNA depletion kit (NEB), and RNA was converted to a DNA library using a TruSeq stranded total RNA kit (Illumina) ...