Labshake search
Citations for New England Biolabs :
3201 - 3250 of 4954 citations for 6 Phenyl 1H imidazo 1 2 b pyrazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 uL BbsI-HF (NEB R3539L, 1 uL T4 ligase (NEB M0202M), and 1uL of an XTEN linker-encoding DNA amplicon ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.3% Tween 20) with 1 μL proteinase K (800 U/ml, NEB) in 96 well plates ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in 1 mL of SOC medium (NEB #B9020S) at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were treated with 1 μl of RNase-free DNase (NEB) to 100 μl of RNA solution and cleaned up with a Monarch RNA cleanup kit (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µl of 10X poly(A) polymerase buffer (New England Biolabs, USA), 0.25 mM ATP ...
-
bioRxiv - Biophysics 2023Quote: ... The lysates were clarified and loaded on 1 mL chitin resin (NEB) and washed with 1 M KCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg of genomic DNA was digested with EcoRI-HF enzyme (NEB) and analyzed using the QX100 system (Bio-Rad) ...
-
bioRxiv - Genetics 2023Quote: ... Approximately 1 μg of genomic DNA was restricted with HinfI (R0155M; NEB) and RsaI (R0167L ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Microbiology 2023Quote: ... MNase digestion was performed by addition of 1 μL MNase (NEB, M0247S) at 37 ℃ for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of template plasmid was digested using 1µL AgeI (NEB, R3552S) for 15h in Cutsmart Buffer (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 µL of Template Switching RT Enzyme Mix (NEB Catalog# M0466L). After mixing ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... endoglycosidase H (500 units, 1 μl, New England Biolabs, catalog no. P0702) was added to each of the SLNYLLYVSN peptide samples ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng genomic DNA was digested with HaeIII (New England Biolabs, R0108L). TBP served as the internal control ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.4 μL Antarctic Thermolabile UDG (1 U/μL; New England Biolabs, M0372S), 5.4 μL Bst2.0 DNA Polymerase (120 U/μL ...
-
Fine tuning of CpG spatial distribution with DNA origami for improved therapeutic cancer vaccinationbioRxiv - Synthetic Biology 2023Quote: SQBs (1 µg) were incubated with 1.0 U/µL DNase I (NEB) with 10 × DNase I buffer diluted in water (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... and 1 µL of Taq Polymerase (5 U/µL, New England Biolabs) to the CIP reaction ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 M NaCl and 8 units/ml Proteinase K (New England Biolabs) in 1x PBS] ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was harvested from 1 million cells using Bio-TRI® (BioLabs) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... the hybrid was reacted with 1 μl RNase H (New England BioLabs) at 37 °C for 30 min and then heated to 90 °C for 10 min to terminate the reaction ...
-
bioRxiv - Genomics 2023Quote: ... except: 1) fragmentation was performed with 30 U PvuII-HF enzyme (NEB) instead of Hpy166II ...
-
bioRxiv - Microbiology 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB, #E6440G), followed by 2×150 bp sequencing on the Illumina MiSeq ...
-
bioRxiv - Cell Biology 2023Quote: ... Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs) in 1x PMP buffer supplemented with 100 μM unlabeled ATP ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR product was digested with 1 unit of MwoI (NEB #R0573S) for 2 hrs at 60°C ...
-
bioRxiv - Microbiology 2023Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μL of 10 mM dNTP mix (NEB N0447S, Ipswich, MA). This initial premix was heated at 65°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl 10 mM mix of dGTP and dTTP (NEB #N0442S, #N0443S), 5 μl 10x T4 DNA Ligase Buffer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were used with 1 µL T4 DNA Ligase Reaction Buffer (NEB, 10x). We found that using these enzymes resulted in higher efficiency and fidelity for the cloning of mismatched gRNA libraries ...
-
bioRxiv - Cell Biology 2024Quote: ... The 3′ cDNA adapter was ligated by T4 RNA ligase 1 (NEB) by incubating at 25 °C for 16h ...
-
bioRxiv - Microbiology 2023Quote: ... The NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (NEB, USA) was used for multiplexing ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μg of the biotinylated lambda DNA is treated with Nt.BspQI (NEB) for 1 hour at 50°C then heat inactivated for 20 minutes at 80°C ...
-
bioRxiv - Biophysics 2023Quote: ... and dGTP were incubated and 10 units of DNA polymerase 1 (NEB) for 6 minutes at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... the reactions were treated with 1 μl of DpnI (New England BioLabs) for 1 hour at 37 °C before gel purification ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.4 µL Antarctic Thermolabile UDG (1 U/µL; New England Biolabs, M0372S), 5.4 µL Bst 2.0 DNA Polymerase (120 U/µL ...
-
bioRxiv - Bioengineering 2023Quote: ... the reactions were treated with 1 μl of DpnI (New England BioLabs) for 1 hour at 37 °C before gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB E7335) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... beads were incubated with 0.5 U/ μl T4 RNA ligase 1 (NEB) in 1x ligase buffer (containing 1 mM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: Unlabeled purified RNA targets were dephosphorylated using 1 U antarctic phosphatase (NEB) incubated with 1X of provided buffer during 20 min at 37°C and then 5 min at 65°C to inactivate the enzyme ...
-
bioRxiv - Biophysics 2024Quote: ... 1 μL of 5U/ μL Klenow Fragment of DNA polymerase I (NEB) and 2 μL of 10 mM dNTP mix (SERVA ...
-
bioRxiv - Genomics 2024Quote: ... 10 µg of RNA was treated with 1 µL Xrn1 (NEB, M0338S) for 1 h at 37 °C to remove decapped ...
-
bioRxiv - Neuroscience 2024Quote: ... with NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB). All libraries were sequenced 150bp paired end using an Illumina Novaseq 6000 with 15 million reads on average per sample.
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM EDTA) and passed through an amylose resin column (NEB#E8021L). Columns were washed prior to recombinant protein elution with 10 mM maltose in column buffer.
-
bioRxiv - Genomics 2024Quote: ... 1% SDS) and 20 μl of Proteinase K (NEB, cat. no. P8107S). Subsequently ...
-
bioRxiv - Bioengineering 2024Quote: ... The cells were grown in 1 mL SOC Outgrowth Medium (B9020, NEB) for 2 h in a standard glass tube at 30 °C with 160 rpm ...
-
bioRxiv - Microbiology 2024Quote: Cell lysates were digested for 1 h with Endo H (P0702, NEB) or PNGase F (P0704 ...
-
bioRxiv - Biochemistry 2024Quote: ... coli exonuclease III (Xth) was performed in NEBuffer 1 (New England Biolabs) with 1 nM enzyme ...