Labshake search
Citations for New England Biolabs :
3151 - 3200 of 6510 citations for 6 Chloro 2 4 chlorophenyl N N dimethylimidazo 1 2 α pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Microbiology 2020Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Neuroscience 2019Quote: Single nucleus RRBS were performed by first sorting PROX+/FOS+ and /FOS- neuronal nuclei in 96-well plates in 3 µL of 0.1× CutSmart buffer (New England Biolabs) per well as described in the Flow Cytometry section of the Materials and Methods ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Genetics 2022Quote: ... Pddx-23::ceDDX23::ddx-23 3’UTR (nEx2971 and nEx2972) was generated by HiFi DNA Assembly (New England Biolabs) of Pddx-23 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Selectively captured polyadenylated RNAs (1μg) were ligated directly to an DNA/RNA hybrid adapter (5’-CTACAC GACGCTrCrUrUrCrCrGrArUrCrUrNrNrN-3’) using T4 RNA ligase (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... These cDNAs along with cDNA of hRIC-3-pHEMH19 were linearized with the restriction enzyme NheI (New England Biolabs). Subsequently ...
-
bioRxiv - Genomics 2019Quote: ... was hybridized to the 3’ adapter and the 5’ adapter ligated by adding 2μL T4 RNA ligase buffer (NEB), 5μL PEG 8000 (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR product was inserted into pcDNA3.1 via 5’EcoRI/3’NotI restriction digestion and a standard ligation protocol (T4 DNA Ligase; New England BioLabs) to create pcDNA3.1-Ncadherin ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of genomic DNA was incubated with 3 µg of in vitro transcribed sgRNAs and 3 µg of purified Cas9 protein in 20µl of 1x NEB3 buffer (New England Biolabs) at 37°C over night ...
-
bioRxiv - Microbiology 2020Quote: pCrPV-3 and pCrPV-1A-DcDV-1A were linearized by digestion with BamHI-HF (New England Biolabs, Ipswich, Massachusetts). Wild-type and CrPV-DcDV RNA was prepared by in vitro transcription of 1 µg linearized plasmid using the mMESSAGE mMACHINE T7 transcription kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... unc-116::tagRFP::tom7 including unc-54 3’-UTR was PCR amplified using Phusion polymerase (NEB, Ipswich, MA, USA) from unc29p::unc-116::tagRFP::tom7 using following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Par-3 PDZ1-APM and PDZ1-APMΔPDZ2 were first his-purified (described above) prior to incubation with amylose resin (NEB). Amylose-bound Par-3 was then washed and resuspended in binding buffer as described for GST proteins.
-
bioRxiv - Cell Biology 2020Quote: PCR amplification of short fragments for screening purposes (<3 kbp) was conducted using OneTaq® (New England Bolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2021Quote: ... Construct included 5’ and 3’ complementary overhangs for ligation into pPICZαA using NEBuilder HiFi DNA Assembly (New England Biolabs) to form pPICZαA_GH43_34 ...
-
bioRxiv - Systems Biology 2021Quote: ... 3 μL of the reverse phasing primer pool (100 nM) and 15 μL of Q5 Mastermix (New England Biolabs). Cycle conditions were 4 minutes at 98°C followed by 20x (30 seconds at 98°C ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were incubated for 5 min on ice and 3 μL of 10X G5 buffer (New England BioLabs, UK) were added to the samples together with 1.5 μL of 25X concentrated protease inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... The tubes were cooled at 42 °C for 10 min before addition of 3 μl of β-agarase (NEB) dissolved in 100 μl MES solution ...
-
bioRxiv - Genomics 2022Quote: ... and water to make up 49 µl) for three hours at 37°C after which 3 µl NlaII (NEB) was added and the reaction incubated at 37°C for a further three hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified mIL-12bC197S-His6 in complex with mIL-12Rβ1D1-D2-His6 was subjected to an overnight Caspase-3 and EndoH (New England Biolabs) digest (1/100 w/w ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.5 µL of 10X GlycoBuffer 3 (Cat.#B1720S; New England Biolabs) and 2.5 µL of Endo Hf in a total reaction volume of 25 µL ...
-
bioRxiv - Plant Biology 2024Quote: ... This end-repaired DNA was subjected to A-tailing using the Klenow 3′–5′ exo− enzyme (New England Biolabs). The subsequent step involved the ligation of methylated adapters to the A-tailed DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1X Protoscript II buffer (50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2) 40 U Murine RNase Inhibitor (NEB), 5 mM DTT and pre-incubated for 10 minutes at 42 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... One piece of brain tissue (∼300 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Genomics 2023Quote: The standard HiDEF-seq v2 protocol was followed with the exception of replacing Klenow fragment 3’→5’ exo-polymerase with one of the following: 9.6 U Bst large fragment (NEB), 9.6 U Bst 2.0 (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were then incubated at 42°C overnight with the addition of 3 μl of β-agarase (NEB). The DNA mix was then gently poured into combing reservoirs containing 1.2 ml MES and the genomic DNA was combed onto salinized coverslips (Genomic Vision ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 μL of Round1 barcode mix (1x T4 DNA ligase buffer, 16 M/μL T4 DNA ligase (M0202L, NEB), 0.25 M/μL RNase Inhibitor ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the second linker SI183 5’-/Phos/NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG/ddC/-3’ was preadenylated by Mth RNA Ligase (New England Biolabs) as described previously8 ...
-
bioRxiv - Microbiology 2023Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified supernatant was then batch-bound for 3 hours on to 20 mL chitin resin (New England Biolabs) equilibrated with 200 mL of cell lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Fragmented RNAs were then dephosphorylated at their 3’ end using T4 Polynucleotide kinase (PNK, New England Biolabs, Cat: M0201) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Molecular Biology 2023Quote: ... The extracted chromatin was digested for 3 hours at 37 °C in a volume of 250.0 μL with 100 U of NlaIII (NEB) for 3C library preparation ...
-
bioRxiv - Cancer Biology 2023Quote: ... adenosines were added to the 3′ ends of dsDNA and adapters were ligated (adapters from NEB, Ipswich, MA, USA). Following the adapter ligation ...
-
bioRxiv - Cancer Biology 2023Quote: ... a DNA adapter (TableS6) was ligated to 3′ ends of nascent RNA using the T4 RNA ligase kit (NEB) by mixing 50 pmol adapter with 300-600 ng nascent RNA ...
-
bioRxiv - Genetics 2023Quote: ... 100 ng of genomic DNA was digested with 5U of BtsCI in a 3 μl reaction (New England Biolabs), 1 hour at 50°C incubation and no enzyme denaturation ...
-
bioRxiv - Microbiology 2023Quote: ... hysA (SAA6008_RS12255) and vigR 3’ UTR from JKD6008 were in vitro transcribed (IVT) using HiScribe T7 RNA polymerase (NEB). IVT products were RQ1 DNase treated (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... the 5’-PPP RNA in the total RNA was specifically capped with 3’-Desthiobiotin-GTP (New England BioLabs, N0761) by the Vaccinia Capping System (New England BioLabs ...
-
bioRxiv - Genomics 2023Quote: ... 5 µg of genomic DNA was dephosphorylated by 3 µL of Quick Calf Intestinal Phosphatase (CIP, New England Biolabs) in a total volume of 30 µL for 10 min at 37°C ...