Labshake search
Citations for New England Biolabs :
3101 - 3150 of 3325 citations for Galectin 1 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: One-cell stage zebrafish embryos were injected with 1-2 nl of injection solution containing 300 ng/μl of Cas9 enzyme (NEB# M0646T) and 12.5 ng//μl of sgRNA ...
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Neuroscience 2023Quote: 2 ug of pX552 vector with SapI gRNA insertion site and Cre-dependent transgene was digested with 1:100 SapI enzyme (BioLabs #R0569S) in 1:10 CutSmart Buffer (BioLabs #B6004S ...
-
bioRxiv - Molecular Biology 2023Quote: ... Seven µL of DNA product was circularized in a reaction with 1 µL of 10X T4 DNA Ligase Reaction Buffer (NEB, #B0202A), 1 µL T4 Ligase (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... Trypsin digestion was initiated by adding 1:10 (trypsin to protein, m/m) mass spectrometry grade trypsin (New England Biolabs #P8101S) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2023Quote: ... The C-terminal truncation of murine STING (to include only amino acids 1-339) was accomplished using NEB Q5 High-Fidelity 2X Master Mix (NEB M0492S) per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... The digested and purified inset and vector were ligated at a ratio of 5:1 using T4 DNA ligase (NEB, M0202) overnight at 18°C ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA was isolated from ∼1 μg of total RNA using NEB Next Poly (A) mRNA Magnetic Isolation Module (NEB #E7490). RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770 ...
-
bioRxiv - Systems Biology 2023Quote: ... four building blocks needed to be prepared: 1) the backbone by digesting pDL00212 with BstEII-HF (New England Biolabs, Ipswitch, MA) and BamHI-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... For the restriction digest 1 µg of genomic DNA from UACa20 and als4112Δ was incubated for 1 hour at 37 °C with the restriction endonuclease BamHI-HF (New England Biolabs (NEB), Ipswich ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... with or w/o 500 µM auxin and the same volume of 2x Monarch DNA/RNA Protection Reagent (NEB #T2011-1) was added before snap-freezing and storage at −80°C until RNA extraction.
-
bioRxiv - Cell Biology 2024Quote: ... Every 2 PCR reactions were pooled and purified in 100ul elution buffer using Monarch PCR & DNA Cleanup Kit (7:1 binding buffer, NEB#T1030L). 5ul/reaction Dynabeads M270 Streptavidin (Thermofisher#65305 ...
-
bioRxiv - Microbiology 2024Quote: ... Rp6 was ligated to mono-phosphorylated transcripts at 37°C for 30 min by adding T4 RNA ligase 1 (#M0204, NEB, USA) with the buffer ...
-
bioRxiv - Microbiology 2024Quote: ... The pBAD33 plasmid harboring the stem structure of rrsH (corresponding to -131∼-102 and +1559∼+1589 relative to +1 of rrsH gene) under T7 promoter was linearized by digestion with XbaI (NEB, R0145).
-
bioRxiv - Genomics 2024Quote: ... 1 µg of genomic DNA was pooled with 1:20 dilutions of unmethylated lambda (1 µl of 0.1 ng/µl) and methylated pUC19 control DNA (1 ul of 0.005 ng/µl) from the EM-seq kit (E7120L; NEB, Ipswich, MA). Volumes were made up to 50 ul with 0.1x TE buffer (Sigma-Aldrich ...
-
bioRxiv - Genomics 2024Quote: ... Supplementary Table 1) using a modified protocol of the NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Biolabs, UK) (Supplementary Methods and Supplementary Table 18 ...
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... embryos were stained with ush Stellaris and lacZ Stellaris probes (Frampton et al., 2022) and nuclei were stained with DAPI (1:1000, NEB 4083). Samples were mounted in ProLong Diamond antifade mountant (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 1 µg of total RNA used for sequencing library construction with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). Raw FastQ files were mapped using Bbsplit from the Bbtools 39.01 suite against Mm10 and hg38 (31 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Assembly reaction was performed at 1:2 vector: insert ratio using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs #E5520) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB, M0264L) for ssDNA digestion at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... the genomic region (∼2000 bp) surrounding the natural start codon on exon 1 was cloned into the pUC19 vector (New England Biolabs, N3041S) by Gibson Assembly ...
-
bioRxiv - Microbiology 2024Quote: ... An enzymatic cleanup was done to remove primer dimers and inactivate nucleotides by directly adding 0.5µL of Antarctic phosphatase and Exonuclease 1 (New England Biolabs, Inc; M0293L, M0289L) and 1.22µL Antarctic phosphatase buffer (1x final concentration ...
-
bioRxiv - Biophysics 2024Quote: ... The N-glycans of Fc were unified by adding 1 nmol of β1-4 Galactosidase S (New England Biolabs, Tokyo, Japan) per 1 unit of glycan terminus (mixed so that the enzyme solution was 10% of the total reaction solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4x106 JM8+/+ and Bmal1-/- cells were fixed with formaldehyde 1% and digested overnight at 37°C using 400U of MboI (New England Biolabs, #R0147M). After filling with 50nM biotin-dATP (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ubl-1::mCherry::pri-mir-58-sensor-mut mutation was introduced into the CMP1 ubl-1::mCherry::pri-mir-58-sensor plasmid using NEB Q5 site directed mutagenesis (New England Biolabs, E0554S) with the primers GGGATGAGATTGTTCAGTACG and TATGGTATTGGACGAAGTG ...
-
bioRxiv - Microbiology 2024Quote: ... N-4005, and N-4004) were used to cap available 3’-terminal ends using terminal transferase (1 µl, 20 units) (NEB #M0315S), TdT reaction buffer (1.5 µl) ...
-
bioRxiv - Molecular Biology 2024Quote: ... A total of 25 μg was then diluted to 100 μL with CP-1 buffer with or without 2 μg/mL proteinase K (New England Biolabs P8107S) and the indicated concentration of digitonin or 2% Triton ...
-
bioRxiv - Molecular Biology 2024Quote: ... This incubation was repeated with a 1:200 pA-Dam solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps ...
-
bioRxiv - Zoology 2024Quote: ... PCR products were electrophoresed and visualized on 1% agarose gels and then were cleaned using Exonuclease I and Shrimp alkaline Phosphatase (New England Biolabs Inc.). Both forward and reverse strands were sequenced using BigDye® Terminator v3.1 cycle sequencing kit ...
-
bioRxiv - Plant Biology 2020Quote: ... and DNA templates and primers listed in Additional Table 1 and cloned into pH7WG plasmid linearized with SalI-HF (NEB, Cataog # R3138S) and AscI (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplification of the GC-rich region (primer 1) was performed with high fidelity Q5 polymerase (New England Biolabs Inc, Ipswich, MA) using the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... using the LTP library preparation kit and employing NEBNext multiplex oligos for Illumina index primer pairs set 1 (New England Biolabs, Ipswich, Massachusetts). Sequencing was performed using a NextSeq 500/550 mid-output v2.5 300 cycle cartridge (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA synthesis was performed from 1 µg total RNA using the ProtoScript® First Strand cDNA Synthesis Kit (New England Biolabs, NEB) with the provided random primer mix according to the suppliers’ instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was generated from 1 μg of total RNA using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, #E6560).
-
bioRxiv - Molecular Biology 2020Quote: ... 13.5 μl digestion reaction product was combined with 1.5 μl second-strand synthesis (SSS) buffer and 1 μl of SSS enzyme mix from the NEBNext mRNA Second Strand Synthesis Module (NEB, Cat #E6111) and incubated at 16 °C for 2.5 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Lachnospiraceae bacterium Cpf1 (LbCpf1) (200 nM) were independently preincubated with sgRNA (600 nM) in cleavage buffer [1× NEBuffer 3 (New England Biolabs, Ipswich, MA), 10 mM DTT ...
-
bioRxiv - Genomics 2019Quote: ... for 1 h at 37 C followed by incubation with 80 U of TaqDNA ligase (New England Biolabs; 50 C/ 30 min). DNA was extracted ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A PCR reaction adding a T7 promoter/terminator pair on each aptamer (see Table 1) was carried out using Q5 High-Fidelity DNA Polymerase (New England Biolabs Inc.(NEB) #M0491 ...
-
bioRxiv - Biochemistry 2020Quote: ... NEB protocol #M0276 with incubation extended to 1 hour) and a Cap 0 analog (using a Vaccinia capping system, NEB protocol #M2080), following the recommended procedures ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). pEGFP-N1 and pEYFP-N1 were obtained from Clonetech (Mountainview ...
-
bioRxiv - Molecular Biology 2019Quote: ... novel donor template for AAV) were assembled in a ratio of 1:2 with Gibson (HiFi) DNA Assembly Master Mix (NEB, cat# E2621S) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: Targeted sequencing for specific off-target or on-target sites was performed via a standard 2-step PCR using gene-specific primers with adaptors in the first round of PCR amplification and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (New England Biolabs) for the second round of PCR amplification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library preparations were performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina with the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, Ipswich, Massachusetts). Library preparation followed the protocol outlined in Saeidi et al ...
-
bioRxiv - Genomics 2021Quote: ... 1 µg of genomic DNA was digested in a 40 µl volume of 1x CutSmart buffer with 1 µl of MFRE (MspJI or FspEI; New England Biolabs, Ipswich, MA) and 1.4 µl activator oligonucleotide (15 µM stock ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Twenty-four PCR reactions (24 x 50 μl) were performed with 1 U of Q5 high-fidelity polymerase (New England Biolabs®, M0491), 200 μM dNTPs ...
-
bioRxiv - Plant Biology 2021Quote: ... #ltp1.4ltp1.8-1 and #ltp1.4ltp1.8-2) were chosen for constructing next generation sequencing libraries following the manufacture’s protocol (NEB Next Ultra II DNA kit). Sequencing was carried out using 2 × 150 paired-end NextSeq500 (1-2 Mio reads for all samples together ...