Labshake search
Citations for New England Biolabs :
3101 - 3150 of 5199 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in 1 mL of SOC medium (NEB #B9020S) at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were treated with 1 μl of RNase-free DNase (NEB) to 100 μl of RNA solution and cleaned up with a Monarch RNA cleanup kit (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µl of 10X poly(A) polymerase buffer (New England Biolabs, USA), 0.25 mM ATP ...
-
bioRxiv - Biophysics 2023Quote: ... The lysates were clarified and loaded on 1 mL chitin resin (NEB) and washed with 1 M KCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg of genomic DNA was digested with EcoRI-HF enzyme (NEB) and analyzed using the QX100 system (Bio-Rad) ...
-
bioRxiv - Genetics 2023Quote: ... Approximately 1 μg of genomic DNA was restricted with HinfI (R0155M; NEB) and RsaI (R0167L ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Microbiology 2023Quote: ... MNase digestion was performed by addition of 1 μL MNase (NEB, M0247S) at 37 ℃ for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of template plasmid was digested using 1µL AgeI (NEB, R3552S) for 15h in Cutsmart Buffer (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 µL of Template Switching RT Enzyme Mix (NEB Catalog# M0466L). After mixing ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... endoglycosidase H (500 units, 1 μl, New England Biolabs, catalog no. P0702) was added to each of the SLNYLLYVSN peptide samples ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng genomic DNA was digested with HaeIII (New England Biolabs, R0108L). TBP served as the internal control ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.4 μL Antarctic Thermolabile UDG (1 U/μL; New England Biolabs, M0372S), 5.4 μL Bst2.0 DNA Polymerase (120 U/μL ...
-
Fine tuning of CpG spatial distribution with DNA origami for improved therapeutic cancer vaccinationbioRxiv - Synthetic Biology 2023Quote: SQBs (1 µg) were incubated with 1.0 U/µL DNase I (NEB) with 10 × DNase I buffer diluted in water (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... and 1 µL of Taq Polymerase (5 U/µL, New England Biolabs) to the CIP reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... prior to incubation with 1% SDS and proteinase K (20mg/mL, NEB) to inactivate and degrade pA-Tn5 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg RNA was converted into cDNA using ProtoScript II RT (NEB), oligo(dT)s and Murine RNAse inhibitor (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Approximately 1 μg of genomic DNA was restricted with HinfI (NEB, Cat.R0155M) and RsaI (NEB ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using 1/8 reaction of NEBNext dsDNA Fragmentase (#M0348, New England Biolabs) incubated at 37°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 ug of DNA was incubated with 6U RNAse H (NEB, M0297) at 37 °C for 2 h ...
-
bioRxiv - Genomics 2023Quote: 1 µg of each library in pDONR223 was digested with Blp1 (NEB) for 1 h 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs) in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and reaction samples were loaded onto 1 ml of amylose resin (NEB). Proteins in the flow-through fractions were further purified by gel filtration chromatography (Superdex 200pg ...
-
bioRxiv - Plant Biology 2024Quote: ... ble cassette and 1 kb 3’ homologous arm onto the BamHI (NEB) digested backbone of pUC57 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Chromatin was washed once by 1× T4 DNA ligase buffer (NEB, B0202) and pelleted by centrifugation.
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μL of 10 mM dNTP mix (NEB N0447S, Ipswich, MA). This initial premix was heated at 65°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl 10 mM mix of dGTP and dTTP (NEB #N0442S, #N0443S), 5 μl 10x T4 DNA Ligase Buffer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were used with 1 µL T4 DNA Ligase Reaction Buffer (NEB, 10x). We found that using these enzymes resulted in higher efficiency and fidelity for the cloning of mismatched gRNA libraries ...
-
bioRxiv - Cell Biology 2024Quote: ... The 3′ cDNA adapter was ligated by T4 RNA ligase 1 (NEB) by incubating at 25 °C for 16h ...
-
bioRxiv - Microbiology 2023Quote: ... The NEBNext Multiplex Oligos for Illumina (Index Primer Set 1) (NEB, USA) was used for multiplexing ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μg of the biotinylated lambda DNA is treated with Nt.BspQI (NEB) for 1 hour at 50°C then heat inactivated for 20 minutes at 80°C ...
-
bioRxiv - Biophysics 2023Quote: ... and dGTP were incubated and 10 units of DNA polymerase 1 (NEB) for 6 minutes at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... the reactions were treated with 1 μl of DpnI (New England BioLabs) for 1 hour at 37 °C before gel purification ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.4 µL Antarctic Thermolabile UDG (1 U/µL; New England Biolabs, M0372S), 5.4 µL Bst 2.0 DNA Polymerase (120 U/µL ...
-
bioRxiv - Bioengineering 2023Quote: ... the reactions were treated with 1 μl of DpnI (New England BioLabs) for 1 hour at 37 °C before gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1, NEB E7335) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... beads were incubated with 0.5 U/ μl T4 RNA ligase 1 (NEB) in 1x ligase buffer (containing 1 mM ATP ...
-
bioRxiv - Molecular Biology 2023Quote: Unlabeled purified RNA targets were dephosphorylated using 1 U antarctic phosphatase (NEB) incubated with 1X of provided buffer during 20 min at 37°C and then 5 min at 65°C to inactivate the enzyme ...
-
bioRxiv - Biophysics 2024Quote: ... 1 μL of 5U/ μL Klenow Fragment of DNA polymerase I (NEB) and 2 μL of 10 mM dNTP mix (SERVA ...
-
bioRxiv - Immunology 2022Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB, E7335S) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... This was then treated with 1 U Endo Hf (New England Biolabs) per 1 μg of NF155 ...
-
bioRxiv - Immunology 2022Quote: ... a 1 in 200 dilution of SNAP-Oregon cell permeable ligand (NEB) was added.
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with 1 mM vanadate (New England BioLabs, Ipswich, MA.).
-
bioRxiv - Genomics 2022Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Genomics 2022Quote: ... 3′ Adapter ligation was done using T4 RNA Ligase 1 (NEB, M0204L). A first binding to streptavidin beads (NEB ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were dual-indexed (NEBNext Dual Index Primers Set 1, NEB E7600S), and sequenced on an Illumina NextSeq 2000 instrument with P3 300 cycle reagents ...
-
bioRxiv - Genomics 2022Quote: ... two adaptor ligations using T4 RNA Ligase 1 (catalog no. M0204; NEB) and reverse transcription using SuperScript III Reverse Transcriptase (catalog no ...