Labshake search
Citations for New England Biolabs :
2951 - 3000 of 3806 citations for Recombinant Mouse Scavenger Receptor Class B Member 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... A cocktail of guide RNAs for each target (1 μL each) was pre-incubated with Cas9 protein (NEB #M0646M) and 0.68uL KCl (as described in (100)) ...
-
bioRxiv - Cell Biology 2024Quote: ... and TE buffer, DNA was reverse crosslinked by incubating beads in Elution buffer (1% SDS, 0.1M NaHCO3 and Proteinase K (NEB)) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The PCR reaction was set up with 1 µL of the supernatant in a 12.5 µL reaction with Taq polymerase (NEB), according to manufacturer’s instruction.
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of entry vector (backbone), 0.5 μL of type IIs restriction enzyme (BsaI, BsmBI or BbsI-HF) (NEB), 0.5 μL of T4 DNA Ligase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... each plug was incubated in 160 μl of 1x NEBuffer 3.1 containing 1 unit/μl of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× NEBuffer 3.1 buffer containing 160 units of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Molecular Biology 2023Quote: ... in buffer 3 (100 mM NaCl, 50 mM Tris-HCl, pH 7.9, 10 mM MgCl2, and 1 mM DTT, New England Biolabs) or in 50 mM NaCl ...
-
bioRxiv - Genomics 2023Quote: ... Following this, 2μL Exonuclease 1 (20U/μL, Enzymatics X8010L) and 1μL Shrimp Alkaline Phosphatase (rSAP) (1U/μL, NEB M0371L) was added to each reaction followed by vortexing and incubation in a thermocycler at 37°C for 30min followed by 4°C forever.
-
bioRxiv - Molecular Biology 2023Quote: ... aurantiaca DW4/3–1 genomic DNA and cut by restriction enzymes NdeI and HindIII (New England Biolabs, Beverly, USA), and ligated into the corresponding sites of the expression vector pET28c(+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Molecular Biology 2023Quote: NCBP1-NCBP2 at 1.2 μM was incubated with mALYREF2 (residues 1-155) at 3.6 μM in the presence of the 5’ cap analog m7GpppG (NEB) at 500 μM at 4 °C for 0.5 hr ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM DTT (catalog no ...
-
bioRxiv - Cell Biology 2023Quote: ... the culture was diluted to 0.1 OD before adding 1 μM silicon-rhodamine benzylguanine derivative SNAP-SiR647 (SNAP-Cell 647-SiR, New England Biolabs). Culture tubes were wrapped in aluminum foil and incubated on a rotator for 15 hours ...
-
bioRxiv - Microbiology 2023Quote: A 10 µL reaction containing 200 ng of pTrc200HA plasmid DNA and 1× CutSmart Buffer (New England BioLabs, USA) with partially purified V2c or its variants normalized by the major V2c protein band was incubated at 37°C for 1 hour ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated in dye solution (1 μM SNAP-tag ligand BG-AF647 (catalog no. S9136S, New England Biolabs), 1 mM dithiothreitol (catalog no ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... mixed in a ratio 1:3 (insert:backbone plasmid) and ligated with T4 ligase according to manufacturer’s instructions (Quick Ligation kit, NEB M2200). The ligation reaction was transformed into competent TOP-10 bacteria and plated on agarose plates with Ampicillin ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was synthesized from 1 µg total RNA using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB) with d(T)23VN primer.
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barcoded 3’ adapters (see Extended Data Table 1) were ligated using K227Q truncated T4 RNA ligase 2 (NEB, M0351L) at a concentration of 0.5 µM adapter and in the presence of 25% PEG8000 containing a homemade 10 x ligation buffer (0.5 M Tris pH 7.8 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg mL−1 BSA at pH 7.9; New England Biolabs). The reactions were incubated at 37 °C for 20-45 min ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.81 nmol LbCas12U protein and 0.45 nmol of each of three crRNAs were assembled in 1 x Nuclease Reaction Buffer (NEB). Protein and crRNAs were mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were split into two equal samples and incubated at 50°C for 25 minutes with exonuclease 1 (NEB, M0293) to remove unintegrated barcoded transposon adapters ...
-
bioRxiv - Immunology 2024Quote: ... MO were stored at 4°C in water at 1 mM and diluted for injections with 0.5X CutSmart Buffer (NEB) and 0.1% phenol red ...
-
bioRxiv - Biochemistry 2024Quote: ... and clarified by centrifugation at 16,100 x g for 1hr and incubated with ∼1 mL of pre-equilibrated compact amylose affinity resin beads (NEB). The resin was washed three times with buffer H ...
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... a 30 uL aliquot of lysate was transferred to a clean 1.5 mL microcentrifuge tube and incubated with 1 uL Endo-H (NEB) for 45 min in a 37C bead bath ...
-
bioRxiv - Microbiology 2024Quote: ... Flanking regions of 1 kb on either side of the target gene were PCR amplified using Q5 polymerase (NEB) and cloned into pLGB13 using the NEBuilder HiFi cloning kit (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 1:200 dilution of the double-stranded gRNA was ligated into BsmBI-digested plasmids using T4 ligase (NEB). One µL of the ligated vector was then transformed into chemically competent XL Gold E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All reactions were then digested with 1 µl ExoI and purified using the Monarch DNA Gel Extraction Kit (NEB), eluting in 10 µl of elution buffer (10 mM Tris•Cl pH 7.4) ...
-
bioRxiv - Plant Biology 2020Quote: ... and cDNA was synthesized from 1 µg of total RNA using ProtoScriptR II Reverse Transcriptase (New England BioLabs, MA, USA) in 20 µl reaction with oligo (dT ...
-
bioRxiv - Plant Biology 2019Quote: ... For alkaline phosphatase treatment, microsomal pellets were obtained as described previously (Inada et al., 2004) and resuspended in the 1× NEBuffer 3 (NEB) with 0.5% Triton-X100 and protease inhibitor mixture (Complete Mini EDTA-free ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and +1 sites of the promoters controlling transcription of both RNAs were used to amplify the standard pUC19 plasmid (NEB). After PCR amplification samples were digested with DpnI (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Ni-NTA resin elute was immediately diluted with PBS containing 1 mM EDTA (PBS-E) and incubated with amylose resin (New England Biolabs) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was then diluted 1:10 with nuclease free water prior to adding 1 µL to a PCR reaction containing 500 uM forward and reverse primer and 1X Q5 Master Mix (NEB). Reactions were cycled 35 times with annealing temperatures calculated by NEB Tm calculator prior to loading on 2% agarose gels ...
-
bioRxiv - Molecular Biology 2019Quote: ... As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S). Next ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μg/ml phenylmethylsulfonyl fluoride and protease inhibitor) and resuspended again in 1 ml MNase digestion buffer with 1,250 Units MNase (NEB Biolabs). Chromatin-MNase mix was incubated at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Endogenous mRNA was removed by treating the pooled fractions (200 μL) with 2.4 μL CaCl2 (40 mM stock) and 1 μL micrococcal nuclease (New England BioLabs M0247S) at room temperature for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA coding region corresponding to RDGBPITPd-FFAT (amino acids 1-472) was subcloned into pUAST-attB by using the restriction enzymes NotI and XbaI (NEB). Similarly ...
-
bioRxiv - Genetics 2021Quote: ... ChIP-Seq libraries were prepared from 1-40 ng of DNA using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Adaptors were diluted 10-fold prior to ligation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Following the adaptor ligation each sample was mixed with 20 μl of a 2x DpnII Digestion Buffer and 10 units (1 μl) of DpnII restriction enzyme (New England Biolabs) mastermix and were incubated for 3 hours at 37 °C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The resulting library was pooled into 12 separate 60 amino acid long sub-libraries (amino acids 1-60, 61-120 etc.) and combined via Gibson Assembly (NEB) with a linearized p414ADHΔter Hsp90 destination vector ...
-
bioRxiv - Genetics 2021Quote: ... 1 μg of RNA was reverse transcribed in cDNA using random hexamers and M-MuLV reverse transcriptase (New England Biolabs). Quantitative PCRs were assembled with Absolute QPCR ROX Mix (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: ... All the other gDNA from the bacteria presented in Table 1 were isolated using the Monarch genomic DNA purification kit (T3010S, New England Biolabs). Xp12 phage genomic DNA was obtained from Peter Weigele and Yian-Jiun Lee at New England Biolabs.
-
bioRxiv - Microbiology 2019Quote: ... The purified DNA was used as template to perform the 2nd step PCR using NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (New England Biolabs), followed by Bioanalyzer analysis and gel purification ...