Labshake search
Citations for New England Biolabs :
2951 - 3000 of 3493 citations for 7 METHYL PHENAZINE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... To subclone this pool we digested our protospacer-empty Libr.1-null transfer vector with BsmBI-v2 (New England Biolabs, NEB) overnight at 55 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... DIG- and FITC-labeled antisense RNA probes were generated from 1 µg of linearized plasmid template using T7 or Sp6 RNA polymerases (NEB) and DIG-11-UTP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of total RNA was used for standard library preparation using NEBNext PolyA mRNA magnetic isolation module (NEB, E7490). In brief ...
-
bioRxiv - Cell Biology 2023Quote: ... the KCNJ16 gene was amplified with 1× Q5 Hot Start High-Fidelity master mix (New England Biolabs, Ipswich, United Kingdom), 0.5 μM forward primer (‘5-‘3 CTACCCGCCAGAGCACATTAT ...
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs). The genomic region surrounding the spo11uc73allele was amplified for 35 cycles with an annealing temperature of 57°C and products were resolved without digestion48 ...
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... Probes were hybridised in FISH hybridization buffer (50% formamide, 20% dextran sulfate, 2X SSC, 1 μg/μL BSA (New England Biolabs), 10 mM vanadyl-ribonucleoside complex ...
-
bioRxiv - Cell Biology 2024Quote: THP-1 monocytes were harvested and lysed for RNA extraction using the Monarch Total RNA Miniprep kit (New England Biolabs), according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... a five-fold molar excess of oligonucleotides bearing either 8-oxo-G or G was mixed with the phage-extracted circular single-stranded DNA in 1=×=Phusion HF Buffer (New England BioLabs). After denaturation at 90=°C for 2=min followed by rapid cooling ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL resuspended plaque were used for each PCR in 10 µL scale in the presence of 1 x High Fidelity PCR Master Mix (NEB) and 500 nM NudE.1 fwd and rev screening primer (Supplementary Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... The linearized vector and PCR-amplified sequences were mixed at a 1:2 molar ratio and assembled using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and used as a template for barcode amplification in a 1-step PCR with Q5 polymerase with high-GC buffer (NEB). Indexed samples were sequenced on a NextSeq 550 in high-output mode (Donnelly Centre ...
-
bioRxiv - Microbiology 2023Quote: The eluted gDNA was resuspended by pipetting to make the beads and elution as homogenous as possible before 20 µL was used in a 40 µL digest using 1 µL of nucleoside digestion mix and 4 µL 10X buffer following the protocol for Nucleoside Digestion Mix (NEB) in an unskirted PCR plate ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3’ adapters with 5’-adenylated RNA adapter (see 3’ adapters in table below) were ligated to the recovered small RNAs using Rnl2(1-249)K227Q RNA ligase (M0351, New England Biolabs) according to the manufacturer’s instructions at 4°C overnight with shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 200 µM ATP with ot without 1 µl of recombinant PKA catalytic subunit (PKAc; New England Biolabs) in manufacturer-supplied reaction buffer at 30° C for 30min with agitation ...
-
bioRxiv - Genomics 2023Quote: ... 5′-Tru-Seq small RNA adapters were ligated on to the de-capped RNA with T4 RNA Ligase 1 (NEB) in the presence of ATP and cDNA synthesized following Illumina small RNA-seq protocol ...
-
bioRxiv - Genomics 2023Quote: The circularized cDNA (1 µL) was amplified by PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB M0494L) in a 25 µL reaction containing 12.5 pmoles of forward and reverse primers (primers listed in Supplementary Table 2) ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was diluted 1:10 and 3 µl of diluted cDNA was used as input for qPCR using Luna by NEB master mix for a 20 µL total reaction ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as template for the 2nd PCR where Illumina barcodes were added by NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1 and 2) (New England Biolabs). PCR products were purified using AMPure XP beads (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of cDNA was used in a 50 μl PCR reaction containing 1 μl of 10 μM PCR primer and 25 μl of 2x LongAmp Taq Master mix (NEB). PCR was performed as shown in Supplementary Protocol ...
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of purified total RNA was reverse transcribed using the ProtoScript II First Strand cDNA Synthesis Kit (#E6560, NEB) and random hexamer primers to obtain 50ng/μl cDNAs.
-
bioRxiv - Molecular Biology 2023Quote: The starting library strand (50 pmol) and regeneration hairpin (75 pmol) (Supp. Table 1) were combined in a 1X ligation buffer (New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by PCR amplification of the mCTX2-PexoT-ZTP-lacZ plasmid using the three GA primer pairs (Table 1) followed by NEBuilder assembly (NEB). The resulting PexoT-ZTP(M4)-lacZ reporter fusion was integrated in the P ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.7 µl of the sample of eluted extension products were included in a 10 µl T4 RNA ligase 2 truncated KQ reaction (1× T4 RNA ligase buffer (NEB), 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The washed pellet was resuspended in TM2 buffer with 1 mM CaCl2 and 12000 U of MNase (New England Biolabs), incubated at 23°C for 15 minutes and the reactions stopped by addition of 0.5 mM EGTA ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... An insert downstream of aga2 was amplified from pYD2 using primers PK463+PK464 in a 1 ml PCR reaction (Q5 High-Fidelity 2X Master Mix, NEB), DpnI digested for 2 h and SPRI purified ...
-
bioRxiv - Molecular Biology 2023Quote: ... Harvested cells were rinsed with ice-cold PBS and resuspended in lysis buffer with 1% Triton X-100 and 40 U/mL murine (New England Biolabs) for 20 minutes with intermittent tapping on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10ng of purified BbsI linearized UniSAM or BsmBI linearized pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP was ligated with 1 μl of diluted annealed gRNA with 0.5 μl of T4 ligase (New England Biolabs, #M0202L) in a total volume of 10 μl ...
-
bioRxiv - Microbiology 2023Quote: Lysates of HEp-2/ι1hUNGs cells mock infected or infected with wild-type HSV-1(F) at an MOI of 10 for 24 h were treated with alkaline phosphatase (CIP) (New England BioLabs) as described previously48.
-
bioRxiv - Biophysics 2023Quote: ... cells were labeled for 30 min at 37° C with 1 µM Surface BG-Alexa546 (impermeable dye; New England Biolabs) for SNAP in extracellular buffer (EX ...
-
bioRxiv - Biophysics 2023Quote: Aliquots of thawed biomolecule samples (single-stranded RNA [ssRNA] ladder [NEB #N0362], 1 kilobase [kb] double-stranded RNA [dsRNA] ladder [NEB #N0363] ...
-
bioRxiv - Genomics 2023Quote: ... 30 minutes at 72°C and finally held at 4°C until 1 μl Exonuclease I (20U/μl, catalog num. M0293S, NEB) was added to each sample ...
-
bioRxiv - Cancer Biology 2023Quote: Each pair of top and bottom oligonucleotides were phosphorylated and annealed by incubating 10 µM of each with 1 × T4 DNA ligase buffer (New England Biolabs), 5U T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Endo H digestion was performed at 37°C for 1h in the presence of 1X GlycoBuffer 3 and 1 µL of Endo H enzyme (NEB). The lysates were boiled and subjected to SDS-PAGE and western transfer ...
-
bioRxiv - Neuroscience 2023Quote: ... (see the sequence map in Figure 1) was subjected to restriction digestion using two restriction enzymes: XbaI and AccI (New England Biolabs (NEB)) in the cutsmart buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 1-118 and AA 119-356 were amplified from a mixed-stage N2 cDNA library using Phusion DNA polymerase (NEB) with gene-specific primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:100 10 mg/mL BSA in distilled water) with 0.75 µL (150 U) micrococcal nuclease enzyme solution (1:10 micrococcal nuclease (NEB, USA) in micrococcal nuclease reaction buffer) ...
-
bioRxiv - Cell Biology 2023Quote: ... To remove RNA secondary structure and anneal the mRNA capture primer 1 μL of tagged random hexamer (100 μM) and 0.5 μL of 10 mM dNTPs (dNTP solution set NEB - N0446S) were added to the sample ...
-
bioRxiv - Biophysics 2023Quote: ... we digested #126-pSC-T7A1reverse-parS with SpeI-HF and BamHI-HF 1 h at 37°C and heat-inactivated for 20 min at 80°C (New England Biolabs). Subsequently we ran the digested fragment on a 1% TAE agarose gel and the desired ∼14 kbp DNA fragment was isolated from an agarose gel using a gel purification kit (Promega ...
-
bioRxiv - Biophysics 2023Quote: ... We added the 5’-phospho group on the synthetic parS fragment by adding a T4 kinase for 30 min at 37°C and heat-inactivated 20 min at 65°C in 1x PNK buffer supplemented with 1 mM ATP (T4 PNK, New England Biolabs). Next ...
-
bioRxiv - Biophysics 2023Quote: ... we mixed the digested constructs and handles in a 1:10 molar ratio and ligated them together using T4 DNA ligase in T4 ligase buffer (New England Biolabs) at 16°C overnight ...
-
bioRxiv - Biophysics 2023Quote: ... We combined the plasmid backbone with the colony PCR insert by mixing them in molar ration 1:3 in the 2xHiFi mix (New England Biolabs). We incubated the reaction at 50°C for 60 min ...
-
bioRxiv - Biophysics 2023Quote: ... and cloned into Sal I-digested GST vector pGEX-6P-1 (Cytiva) by NEBuilder HiFi DNA Assembly cloning (New England BioLabs). To express the GST fusion protein ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng of Cy5-labeled and biotinylated DNA was incubated with 1 μg of streptavidin (SA, New England Biolabs, #N7021) in 25 μL of binding buffer (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2023Quote: ... and ΔpreNAC (a.a. 1−36+61−140)) were introduced using the Site-Directed Mutagenesis kit (New England Biolabs, MA, USA). The complete sequences of all recombinant protein constructs used in this study are listed in the Supplementary Information (“Protein construction and sequence” section) ...