Labshake search
Citations for New England Biolabs :
251 - 300 of 8876 citations for Trisodium dichloroanthra 2 1 9 mna naphth 2 3 h acridine 5 10 15 triyl tris sulfate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated (200U; NEB)] was added ...
-
bioRxiv - Biochemistry 2021Quote: ... disulfide bonding enhancer 1 and 2 (New England BioLabs), RNase inhibitor (Takara Bio Inc. ...
-
bioRxiv - Genomics 2021Quote: ... or 2 mU DNase 1 (Cat. No. M0303S; NEB) and 0 ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: RNase H 5 U/µL (NEB, Cat#M0297S)
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was collected at 9 h post-IFN treatment using Monarch Total RNA Miniprep Kits (NEB). RNA was prepped for RNA sequencing submission using the NEBNext Poly(A ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Neuroscience 2021Quote: ... with 1% (w/v) octylglucoside containing 5 U endoglycosidase H (Endo H) or peptide: N-glycosidase F (PNGase F; both NEB, Frankfurt, Germany) at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant solution was incubated for at least 2□h with amylose-affinity chromatography resin (New England Biolabs), whilst gently shaking at 4□°C ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Biophysics 2021Quote: ... in 500 μl T4 ligase buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP and 10 mM DTT, pH 7.5, NEB). Before adding the ligase ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μl each of two complementary oligonucleotides (Mut_sgRNA_F and Mut_sgRNA_R) (Supplementary file 1) at a concentration of 20 μM and 2 μl of NEBuffer 2 (NEB B7002S) were added into an Eppendorf tube ...
-
bioRxiv - Biophysics 2021Quote: ... following incubation for ∼2 hours of 10 mg/ml BSA (New England Biolabs) diluted in buffer A containing 20 mM Tris ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2μl 10 mM dNTPs and 1μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Biophysics 2021Quote: ... following passivation for ~2 hours of 10 mg/ml BSA (New England Biolabs). After removing non-adhered BSA by washing the flow cell with PBS ...
-
bioRxiv - Genomics 2020Quote: ... 10 µL of 2% bovine serum albumin (New England Biolabs, cat. no. B9000S), 0.3 µL of 1M spermine (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2024Quote: ... 2-10 µg plasmid DNA was digested with BsaI-HF-v2 (NEB R3733) in a 100 µl reaction for 4 h at 37°C and then spin-purified.
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 (NEB #E7500) and 3 (NEB #E7710 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Biochemistry 2020Quote: ... the nonstop GFP1-10 sequence was produced by PCR using primers #1 and 2 and Q5 High-Fidelity DNA Polymerase (NEB) with pETGFP 1-10 vector as a template (Cabantous et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.7 µl of the sample of eluted extension products were included in a 10 µl T4 RNA ligase 2 truncated KQ reaction (1× T4 RNA ligase buffer (NEB), 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA, 2 µL 2000 U/µL MNase, NEB). Digests were centrifuged (5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Unbound material was removed by washing the samples 5x for 5min with head over head rotation at 4°C in wash buffer plus detergent (1x buffer XT, 1% digitonin, 2 mM PMSF and 10% glycerol) using a magnetic separator (New England Biolabs). Bound material was finally eluted with Biotin elution buffer (1x buffer Biotin XT elution ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and Dnase I (1 U/ml, New England Biolabs). Cells were washed and 5-9 x 106 PBMCs were then seeded/well in a 24-well plate in IMDM supplemented with 10 % SAB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 uL aliquots were removed at each time point and added to 2 uL 5 mg/mL Proteinase K (NEB) in 5% SDS ...
-
bioRxiv - Cell Biology 2020Quote: ... RNase H treatment on fixed cells was performed using 5 U RNase H (M0297, NEB) for 3 h at 37°C ...
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl T7 Endonuclease I (1 U/ul, M0302S, NEB) was added and incubated at 37°C for 1 hr ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated K227Q (200U; NEB)] was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...