Labshake search
Citations for New England Biolabs :
251 - 300 of 8870 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The NEBNext rRNA depletion kit (NEB) was used to deplete ribosomal RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEB Miniprep Kits (NEB, T1010).
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Q5 Site-Directed Mutagenesis Kit (NEB) was used according to manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The Monarch RNA Cleanup Kit (NEB) was used to purify the resulting RNA ...
-
bioRxiv - Synthetic Biology 2023Quote: Monarch DNA Gel Extraction kit (NEB), for purifying PCR products products prior to assembly (Note ...
-
bioRxiv - Molecular Biology 2024Quote: ... Q5 site directed mutagenesis kit (NEB) was used to generate various SARS-CoV-2 FSE conformation stabilizing constructs and other length dependent constructs and their sequences were confirmed through sanger sequencing (Eurofins genomics) ...
-
bioRxiv - Cell Biology 2024Quote: ... using the HiFi Assembly kit (NEB). NEBuilder Assembly Tool 2.0 was used to design RRM1-2 primers with 21-bp overlap with the destination vector ...
-
bioRxiv - Immunology 2024Quote: ... The NEBNextII kit (New England Biolabs) was used to prepare the sequencing library ...
-
bioRxiv - Biophysics 2021Quote: The DNA substrate used in the optical trapping assay was a ~3400-bp PCR-amplified section of plasmid PBR322 (New England Biolabs). The forward primer (5’-/btn/-ACA GCA TCG CCA GTC ACT AT-3’ ...
-
bioRxiv - Biophysics 2021Quote: The assembly of GRB2 SH3 and PSD95 PDZ mutant libraries in both assay plasmids were done overnight by temperature-cycle ligation using T4 ligase (New England Biolabs) according to the manufacturer's protocol ...
-
bioRxiv - Genetics 2021Quote: ... The mutagenesis of target sites was confirmed in a subset of somatic mosaics using a T7 endonuclease assay (NEB, UK).
-
bioRxiv - Molecular Biology 2021Quote: LAMP assay was performed in a total volume of 25 μl with Bst 2.0 WarmStart™ DNA Polymerase (New England Biolabs). The reagents ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... The subsequent CRISPR detection was performed by adding 8.75 μL of CRISPR Mix (1X TtCmr Activity Assay Buffer, ~62.5 nM TtCmr complex, 500 nM TTHB144, 2 μL NTP Buffer Mix (NEB #E2050), 25 U Hi-T7 RNA polymerase (NEB #M0658) ...
-
bioRxiv - Neuroscience 2022Quote: ... were designed using the CCTop target online predictor (Stemmer et al, 2015) and cutting efficiency was evaluated by T7EI Assay using T7 Endonuclease I (NEB). We selected the TSC2Ex2-gRNA (TGTTGGGATTGGGAACATCGAGG ...
-
bioRxiv - Bioengineering 2022Quote: ... In vitro Cas9 cleavage assay was carried out using purified IVT product and Cas9 protein (Cas9 Nuclease, S. pyogenes, New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... integrated HIV DNA and unspliced HIV RNA was performed by modified nested real-time PCR assay using Taq DNA polymerase (BioLabs) in the first PCR and TaqMax Fast Advanced Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... Equal volumes of each immunoprecipitated sample were then aliquoted into two tubes and beads were then resuspended with 100 microliters of lambda phosphatase assay buffer containing 400 units of lambda protein phosphatase (NEB), or with 100 microliters of lambda phosphatase assay buffer alone ...
-
bioRxiv - Cancer Biology 2022Quote: ... OFP positive bulk populations were single-cell cloned in 96-well plates and a total of 12 clones screened for mismatches by T7E1 assay (New England Biolabs). Briefly ...
-
bioRxiv - Genetics 2022Quote: ... The promoter was then amplified from the construct prepared for the retrotransposition assay using Q5 High-Fidelity 2x Master Mix (New England Biolabs). Primers and annealing temperatures are listed in Supplemental Table 1 ...
-
bioRxiv - Plant Biology 2020Quote: Recombination assays were performed with single-strand linear ΦX174 virion DNA and double strand circular ΦX174 RFI DNA (New England Biolabs) linearized with PstI in 20 mM Tris-acetate pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins from the supernatant at 2 mg/mL were used for the Co-IP assay using Protein G magnetic beads (New England Biolabs) and a mouse monoclonal anti-HA antibody (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB) to screen for possible edited clones ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...
-
bioRxiv - Biochemistry 2023Quote: Between 1e9 and 1e10 vg were used as input material to bind to different magnetic beads for pulldown assays: SNAP-Capture Magnetic Beads (NEB) for SNAP tag insertion ...
-
bioRxiv - Genomics 2023Quote: ... The polymerase employed in our qPCR stop assays was exonuclease and proof-reading activity deficient Klenow fragment (M0212L; New England Biolabs). The Control DNA (Fig 3A ...
-
bioRxiv - Cell Biology 2023Quote: ... we quantitated the proportion of abnormal DNA fragments generated by the procedure using DNA prepared from the transfected cell population and a polymerase chain reaction (PCR)-based T7 endonuclease assay (New England BioLabs). The PCR was performed with primers flanking the predicted ligation-junction product (forward primer AGAATACCAGGGGGCCATGA and reverse primer AACGAATCCTTTCCCTGGGTC) ...
-
bioRxiv - Biophysics 2023Quote: Oligonucleotides used as substrates in D-loop assays were radiolabelled at their 5′-end using T4 Polynucleotide Kinase (T4 PNK - NEB) and adenosine triphosphate [γ-32P] (Perkin Elmer ...
-
bioRxiv - Microbiology 2023Quote: ... using the kit Luna® Universal qPCR Master Mix Kit (New England Biolabs, Ipswich, MA, United States). PCRs were conducted in a total volume of 20 µl containing 10 μL of Luna Universal qPCR Mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplicon was subsequently purified with column DNA Clean-up kit (Monarch PCR & DNA Cleanup Kit, # T1030L, NEB) and mixed with double-digested Nhe1/ BamH1 and gel-purified target pCW57.1 vector in a molecular ratio of 1:2 (50 ng Vector ...
-
bioRxiv - Microbiology 2021Quote: All PCR assays were carried out in 25 μL total reaction volumes using 2x Mastermix (New England Biolabs Inc., Ipswich, USA), 1.25 μL oligonucleotide primes (10 μM ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Genomics 2022Quote: ... The DNA substrates for in vitro cleavage assays were synthesized using Phusion® Hot Start Flex 2X Master Mix (NEB, M0536S) and purified using GeneJET PCR Purification Kit (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... 89 bp segment surrounding the lesion site. PCR product was processed using T7 endonuclease assay (Fig. S6) per manufacturers instruction (NEB #E3321) to identify retwmr1/+ embryos which were then pooled and processed via previously described HCR and whole-mount immunohistochemical preparations ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted genome DNA was used to amplify the surrounding region of the m.15059G>A mutation for T7 Endonuclease I (T7EI) mismatch detection assay using Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs, USA) in accordance with recent studies 27 ...
-
bioRxiv - Neuroscience 2023Quote: PCR amplicons were tested for the presence of mutations using a T7 endonuclease I assay (New England Biolabs®, Ipswich, USA). 10 μL of each PCR was subjected to electrophoresis on a 1% agarose gel according to the protocol below ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB).
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB). The specificity of AlkB repair reaction was confirmed using an inactive AlkB control reaction in which Fe2+ ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... or FLAG (amino acid sequence: DYKDDDDK) with a kit (Gibson assembly kit from New England Biolabs, catalogue # E5510S). The different combinations were cloned into pJFRC7-20XUAS-IVS-mCD8::GFP (Addgene # 26220 ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the NEBNext Ultra DNA Library Prep Kit (kit number E7370L, New England Biolabs) and 8 cycles of PCR ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated from blood (QiaAmp DNA Mini Blood Kit, Qiagen; or Monarch Genomic DNA purification kit, NEB) or from perfused organs homogenized (Fisher Bead Mill 4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... NEB One Taq RT-PCR kit (One Taq® RT-PCR Kit, New England Biolabs INC, Frankfurt, Germany) was used for cDNA synthesis ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Monarch PCR & DNA Cleanup Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: NEBNext rRNA Depletion Kit (NEB, Cat E6310S) was used to deplete ribosomal RNA according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... The HiScribe Quick T7 kit (NEB, E2050S) was then used for in vitro transcription ...
-
bioRxiv - Molecular Biology 2020Quote: ... a quick ligation kit (New England Biolabs) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Q5 Site-Directed Mutagenesis Kit (NEB E0554S) and restriction cloning were used to generate partial constructs ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Q5 site directed mutagenesis kit from NEB was used for cloning the inserts inferiors at 100 bps ...
-
bioRxiv - Microbiology 2019Quote: ... and end repaired (Quick Blunting Kit, NEB). Transposon junctions were amplified from gDNA by PCR ...