Labshake search
Citations for New England Biolabs :
251 - 300 of 1142 citations for Myelin Basic Protein Biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Protein expression vector pMAL-c5Xa (NEB) was used as the backbone for constructing the mCherry reporter ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein markers (New England Biolabs, #P7719S) were used for molecular mass determination.
-
bioRxiv - Microbiology 2023Quote: ... proteins were deglycosylated by PNGaseF (NEB) prior to gel electrophoresis to facilitate analysis.
-
bioRxiv - Cell Biology 2023Quote: ... and Protein Kinase A (NEB, P6000S) were purchased from New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Bioengineering 2024Quote: ... including protein disulfide bond enhancer (NEB) and GamS (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE ...
-
bioRxiv - Microbiology 2019Quote: ... 1 pmol of DNA template was mixed with 10 pmol of oligonucleotide 9 labeled with Yakima Yellow and 1µL of HemoKlen Taq DNA Polymerase (New England Biolabs) in a 6µL reaction mixture containing 50 mM Tris-HCl pH 9.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... S121A or triple mutant (AAA)) was incubated and labeled in vitro with 2U of CK2 (New England Biolabs, P60105) in a 30µl reaction containing 3pM adenosine triphosphate (ATP) ...
-
bioRxiv - Microbiology 2022Quote: ... Oligonucleotides complimentary to the target were end-labeled with γ-32P-ATP by T4 polynucleotide kinase (New England Biolabs). Labeled oligonucleotides were added to the membrane and incubated overnight at 45°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Biophysics 2023Quote: RNAs were labeled with γ32P-ATP using T4 polynucleotide kinase (PNK) according to the manufacturer conditions (New England Biolabs). Radioactive RNAs were separated from any non-incorporated γ32P-ATP via denaturing 15% polyacrylamide (19:1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Oligonucleotide probe for telomere or Alu repeats was labeled with [32P]-ATP (3,000 Ci/mmol) and T4 nucleotide kinase (New England Biolabs). The membrane was hybridized in Church hybridization buffer containing a 32P-labeled probe at 42°C overnight ...
-
bioRxiv - Genomics 2023Quote: ... cells in the latter plate were labeled with HaloTag Oregon Green and SNAP-Cell 647-SiR (New England Biolabs) simultaneously according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was labeled by fill-in of EcoRI overhangs with the DNA polymerase I Klenow fragment (New England Biolabs) in the presence of [α-32P] dATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2023Quote: Isotope labeled firefly luciferase (Fluc) mRNA was synthesized by HiScribe T7 High Yield RNA Synthesis Kit (E2040S, NEB, Ipswich) using stable heavy isotopes of ATP and CTP (NLM-3987-CA and CNLM-4267-CA-20 ...
-
bioRxiv - Cell Biology 2020Quote: ... supernatant was discarded and fill-in mix was added (38 μM Biotin-14-dATP [Thermo Fisher Scientific], 38 μM dCTP, dGTP and dCTP [Thermo Fisher Scientific], 50 U Klenow Polymerase [NEB], 1x NEB 2 buffer) and cells incubated for 1 h at 37 °C under rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... nuclei were spun down and resuspended in fill-in mix (biotin-14-dATP [Thermo Fisher Scientific], dCTP, dGTP and dTTP [Thermo Fisher Scientific], Klenow Polymerase [NEB], 1x NEB 2 buffer) for 1.5 h at 37°C with rotation ...
-
bioRxiv - Molecular Biology 2021Quote: Biotinylation of SNAP tagged proteins and Avi-tagged proteins were performed as suggested by manufactures (NEB, Avidity). Direct biotinylation of proteins for example-YenB ...
-
bioRxiv - Plant Biology 2020Quote: ... The NRPD1-Maltose Binding Protein (MBP) fusion protein was affinity purified using Amylose resin (New England Biolabs) and eluted with 20 mM maltose ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 µg of purified recombinant WRN protein was treated with Lambda Protein Phosphatase (LPP, New England Biolabs) in 1X PMP buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Microbiology 2022Quote: ... the membranes were hybridized overnight with antisense oligo probes listed in the S6 Table end-labeled with T4-PNK (New England Biolabs) using 32P-γ-ATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SNAP-tagged histones neosynthesized during the chase time were pulse-labeled by incubating cells with 2 μM of red-fluorescent SNAP reagent (SNAPcell TMR star, New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE, NEB) in the presence of GTP and S-adenosylmethionine (SAM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Microbiology 2021Quote: ... was dephosphorylated and 5’ end labeled with P32 as follows: 25 pmol of RNA was dephosphorylated using 50U of Antarctic Phosphatase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the strands of each sequence was then labeled with P32 as follows: 10 pmols of single stranded DNA was incubated with 5 Units of T4 PNK (NEB) and 0.64µCi of P32- γ -ATP (Perkin-Elmer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... pJET1.2 plasmids containing 150 bp FCR monomer sequences were PCR-amplified and fluorescently labeled using random hexamer priming and Klenow (exo-) polymerase (New England Biolabs). Both Alexa Fluor 488 and 568 dUTP-conjugated fluorophores were used ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Immunology 2020Quote: ... A 32P-labeled 368 nt transcript was generated from EcoRI digested probe temple (described below) using T7 RNA polymerase (New England Biolabs). The probe was diluted in the hybridization buffer described above ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 pmol of oligonucleotide was labeled at the 5’ terminus with 0.05 mCi [γ-32P]-ATP using T4 Polynucleotide Kinase (New England Biolabs). For annealing ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 20picomoles of CIP treated RNA was 5’ end labeled with 50μCi of [γ-32P] ATP (10mCi/ mL, BRIT, India) by incubating with T4 polynucleotide kinase (New England Biolabs) at 37°C for 35 min ...
-
bioRxiv - Biophysics 2019Quote: ... and 15-25 μM of BG-oligonuculeotides were labeled with ∼ 1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Zoology 2020Quote: ... Each gel also contained 32P-end-labeled size ladders (Molecular Weigh Marker XV, by Roche Diagnostics and 1Kb DNA ladder by New England Biolabs). After electrophoresis ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB) and amplified 7 cycles by PCR in the presence of SYBR Green in order to obtain an optimal yield ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB) and amplified 9-13 cycles (depending on initial material amount ...
-
bioRxiv - Molecular Biology 2020Quote: ... tRF-5s, itRFs were end-labeled with 32P-ATP (Board of Radiation and Isotope Technology, India) using polynucleotide kinase (NEB), purified through MicroSpin G-25 Columns (GE Healthcare) ...
-
bioRxiv - Biophysics 2021Quote: ... and 15–25 μM BG-oligonuculeotides were labeled with ∼1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa-CENP-A-SNAP cells were grown in 6 well plates and pulse labeled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4µM final concentration ...
-
bioRxiv - Biochemistry 2022Quote: ... a tolerant position was mutated to facilitate making a labeled LexA variant.56 The His-LexA W201C mutant was generated using a Q5 Site-Directed Mutagenesis Kit (NEB) and the mutation was confirmed via sequencing ...
-
bioRxiv - Genomics 2022Quote: ... Two 500 ng reaction tubes of DLE1-labeled DNA were each mixed with 4 μL of 10X CutSmart buffer (New England Biolabs), 60 μM of lab-made synthetic AdoYnATTO643 (see synthesis in the Supplementary Data) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The products were analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel against a 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) and quantitated with a phosphorimager (Typhoon FLA 9500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel with 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) run in a parallel lane ...
-
bioRxiv - Neuroscience 2022Quote: 4 µl procainamide-labeled glycans were combined with 1 µl 10x sodium acetate – Ca2+ buffer (Glycobuffer 1, New England Biolabs), 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 pmol of dephosphorylated and purified RNA was 5′ end-labeled (20 μCi of 32P-γATP) using 1 U of Polynucleotide Kinase (NEB) for 1 h at 37 °C in a 20 μL reaction volume ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 200 µL of phosphate saline buffer (PBS) and labeled by incubation with SNAP-cell TMR-Star (New England Biolabs) for 30 min at 37°C in the dark at a final concentration of 250 nM ...