Labshake search
Citations for New England Biolabs :
251 - 300 of 5034 citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... This strategy avoids 3’-terminal editing of the mismatched primers by the 3’-5’ exonuclease activity of Q5® High-Fidelity DNA Polymerase (NEB), increasing PCR specificity.61
-
bioRxiv - Molecular Biology 2024Quote: ... was used to repair the sonicated DNA and successively 3’ A-tails were added by Klenow Fragment (3’→5’ exo-) (NEB, M0212S) and dATPs (NEB ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 mM EDTA) + 4 μl of Proteinase K (20 mg/ml, NEB) at 55°C (300 rpm continuous shaking in a thermomixer) ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Genetics 2021Quote: ... 2nd cDNA strand was again synthesized using a transcript specific primer (either 5’UTR_βG-intron _F or 5’UTR_CMV _F2, Table 4) and Q5 2x master mix (NEB, #M0494). After another round of bead purification ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 and 6 and then assembled into pASW vector by NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Cell Biology 2024Quote: ... Full length human NHSL1-A1 including Exon 1a and excluding exons 3 and 6 was generated by NEB HIFI assembly using a synthetic DNA fragment (gBlocksTM ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Genomics 2021Quote: ... DNA samples were incubated with 50 μM dATP and 5 U of Klenow Fragment (3’→5’ exo-) (New England Biolabs, M0212) in 30 μl 1 × NEBuffer2 at 37°C for 30 minutes.
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single turnover reactions were carried out as follows: 5 µM Clr4 was preincubated 5 minutes with 1 mM final S-adenosyl-methionine (liquid SAM, 3 2mM, NEB #B9003S), and varying concentrations of pSwi6 or unP Swi6 ...
-
bioRxiv - Genomics 2020Quote: ... with 2 μl (5 U/μl) of Klenow fragment exo- (NEB) in a final volume of 55 μl by incubation at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... and 5 U Klenow in 1× NEBuffer 2 (New England BioLabs) (120 μL total volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl Klenow enzyme (5 units/µl, New England Biolabs, M0210S), and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μl Hot Start High-Fidelity 2× Master Mix (M0494S; NEB) and nuclease-free water to fill up to 10 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Biophysics 2020Quote: ... and 7U/mL Klenow Fragment of DNA Polymerase I (3’-5 exo-) (NEB, M0212). Reactions were incubated at 37°C and incorporation of labeled dCMP was monitored by an acid precipitation assay ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubating with either Klenow Fragment (3’→5’ exo-) (New England Biolabs (NEB), M0212L ...
-
bioRxiv - Developmental Biology 2020Quote: ... act57B sequence: 5’-UCUUCCCCUC-3’ RNA oligonucleotides were end-labeled using T4 Kinase (NEB) with ATP [γ-32P]32 ...
-
bioRxiv - Genomics 2022Quote: ... the end-repaired DNA was mixed with Klenow Fragment (3′ → 5′ exo−) (NEB, #E6044A) in NEBNext dA-Tailing Reaction Buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then 3’-end dephosphorylated and 5’-end phosphorylated using T4 polynucleotide kinase (NEB). tRNA library preparation used SuperScript™ IV following the QuantM-tRNA-seq protocol (Pinkard et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... was designed with 4 nt 5’ overhangs that match 5’ overhangs of the pCsm vector left by linearization with BbsI (NEB). 10 pmoles of each oligonucleotide set were annealed in 1X CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Microbiology 2024Quote: ... protein aliquots were subjected to PNGase F or a broad range mannosidase (α1,2/3/6) (New England Biolabs, France) digestion according to the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... A 3’ A overhang was added to the ends of the blunted DNA fragment with Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments was then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Genomics 2024Quote: ... 2 μL of 10% Tween-20 and 5 μL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...