Labshake search
Citations for New England Biolabs :
251 - 300 of 5323 citations for 6 Chloro 3 4 dihydro 4 methyl 3 oxo 2H 1 4 benzoxazine 8 carboxylic Acid d3 Methyl Ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: Whole Methylome Sequencing (WMS) was performed on genomic libraries prepared using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs) following the manufacturer instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... EM-seq libraries were prepared from sheared DNA using an enzymatic methyl-seq kit following the standard instructions (New England BioLabs), and were subjected to NextSeq550 using 75bp paired-end sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: A range of 5 to 30 ng of cfDNA was used to generate WMS libraries with NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) per manufacturer instructions.
-
bioRxiv - Genetics 2023Quote: ... The sheared DNA was then used as a template for libraries prepared with a NEBNext Enzymatic Methyl-seq Kit (EM-seq) (New England Biolabs). We note that our previous attempts to develop a hybridization capture protocol using bisulfite-converted DNA were unsuccessful ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 cycles on a Covaris E220 focused ultrasonicator and were subsequently processed using NEBNext Enzymatic Methyl-Seq kit (NEB #7120) following the manufacturer protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... The sheared gDNA was then used to prepare EM-seq libraries using the NEBNext Enzymatic Methyl-seq kit (NEB, #E7120S) following the manufacturer’s standard size library protocol ...
-
bioRxiv - Microbiology 2023Quote: Verified amplicons were combined with the pMV306H integrative vector backbone at a ratio of 1:1 v/v and allowed to ligate overnight at 4°C with T4 DNA ligase (NEB). Ligation products were subsequently transformed into chemically competent DH5ɑ E.coli ...
-
bioRxiv - Neuroscience 2022Quote: 4 µl procainamide-labeled glycans were combined with 1 µl 10x sodium acetate – Ca2+ buffer (Glycobuffer 1, New England Biolabs), 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock ...
-
bioRxiv - Synthetic Biology 2021Quote: ... for 4 hours at 37°C and treated with Antarctic phosphatase (NEB) for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Annealed oligos were mixed with 4 μL 6X loading dye (NEB, B7024S), loaded onto a lab-made 8% TBE gel (Acrylamide/Bis solution 37.5:1 ...
-
bioRxiv - Genomics 2020Quote: ... the circularized DNA was incubated in 1x NEBuffer 4 reaction buffer (NEB) (50 mM potassium acetate ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Systems Biology 2020Quote: ... a 4-cycle PCR was performed with OneTaq polymerase (New England Biolabs) in 200 reactions (125 μL/reaction) ...
-
bioRxiv - Microbiology 2021Quote: ... The parental plasmid was digested for 4 h using Dpn1 endonuclease (NEB) at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... a mix of 4 μl First strand Synthesis Reaction Buffer (NEB-kit), 0.5 μl Murine RNase Inhibitor (NEB-kit ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 20 mg/mL RNase A (New England Biolabs #T3018L) is added to the RNase positive aliquot of non-lysed TSB from 1-gram cannabis flower homogenate ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 mM EDTA) + 4 μl of Proteinase K (20 mg/ml, NEB) at 55°C (300 rpm continuous shaking in a thermomixer) ...
-
bioRxiv - Developmental Biology 2021Quote: ... by incubating with DNA polymerase I Klenow (4 mL; New England Biolabs) for 90 min at 37C with rotation ...
-
bioRxiv - Genetics 2023Quote: ... 4 µl Luna universal qPCR Master Mix (New England Biolabs, Hitchin, UK) and 1.8 µl ultrapure water ...
-
bioRxiv - Developmental Biology 2024Quote: ... 47 ml water) and 4 µL 10mg/ml Proteinase K (P8108S, NEB). The samples were incubated for 8 hours at 55 °C followed by 10 min at 98 °C to inactivate the Proteinase K ...
-
bioRxiv - Biochemistry 2024Quote: ... then subsequent addition of 4 units of proteinase K (New England Biolabs) and incubation at 55 °C for 30 min ...
-
bioRxiv - Biophysics 2024Quote: ... 4 mM BME) and added to an amylose resin (New England Biolabs), incubating overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... and subsequently incubated with 4 U of alkaline phosphatase (New England Biolabs) at 37°C for 30 min to hydrolyze unreacted NTPs ...
-
bioRxiv - Cell Biology 2024Quote: ... 40U (4 µL) T4 polynucleotide kinase enzyme (T4 PNK; NEB, Cat #M0201S), 4 µL 10X T4 Ligase Buffer (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-cleaved caspase-3 1:100 (9661, NEB), rat anti-p21 1:100 (ab107099 ...
-
bioRxiv - Cell Biology 2024Quote: ... coli competent cells (D3,NEB-C2527H) were transformed with a pSANG10-3F-BG4 plasmid (Addgene #55756) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μg of the purified DNA was digested with 8 units of Endo V (New England Biolabs) in a 200 μL reaction at 37 °C for 2 h ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Cell Biology 2020Quote: ... The extract was incubated for 1 h at 4 °C with amylose resin (New England Biolabs, Ipswich, MA), loaded onto a column ...
-
bioRxiv - Biochemistry 2022Quote: ... The unbound fraction was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 million permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting Gβ1γ2 was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 1 μl of a 4-fold dilution of Low Range ssRNA Ladder (New England Biolabs) and 0.75 pmol each of RPIX_SC1_Bridge ...
-
bioRxiv - Biochemistry 2024Quote: ... The unbound fraction was then incubated for 1 h at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Genomics 2024Quote: ... NEBNext Multiplex Oligos for Illumina (Index Primer Sets 1-4) (Cat# E7335L, E7500L, E7710L, E7730L, New England Biolabs) were used for indexing during library preparation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unmethylated cytosines were then deaminated to uracil and indexed libraries were prepared using the NEBNext Enzymatic Methyl-seq Kit (NEB #E7120) before being pooled and then sequenced by Illumina paired-end (2×150bp ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries for genome wide DNA methylation profiles were generated from 200 ng of genomic DNA using NEBNext® Enzymatic Methyl-seq Kit (New England Biolabs). These libraries were sequenced on an Illumina NextSeq 2000 to generate 100 bp paired end reads.
-
bioRxiv - Molecular Biology 2022Quote: The library for EM-seq was prepared using 200 ng DNA input and the NEBNext Enzymatic Methyl-seq Kit (NEB, E7120S) following the manufacturer’s instructions for a standard insert (370-420 bp) ...
-
bioRxiv - Cancer Biology 2024Quote: EM-seq libraries were prepared from genomic DNA as previously (78) using the NEB Enzymatic Methyl-seq kit (New England BioLabs; P7120L). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... The APOBEC3A and BSA materials used were purchased from the NEBNext© Enzymatic Methyl-seq Conversion Module kit from New England Biolabs (NEB). The reaction volume was then scaled down to 15.5 uL and modified from the original deamination protocol from the kit ...
-
bioRxiv - Genomics 2024Quote: ... Libraries were made according to the manufacturer’s directions for the NEBNext Enzymatic Methyl-seq kit (New England Biolabs, Cat. No. E7120S) using the S220 Focused-ultrasonicator (Covaris ...
-
bioRxiv - Genomics 2024Quote: Methyl-CODEC library amplification was performed by adding 25 μl Q5U Hot Start High-Fidelity DNA Polymerase (NEB, Catalog no. M0515) and 5 μl KAPA Library Amplification Primer Mix (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway™ pENTR™ 4 by mixing the linearized vector backbone and PCR product in a 1:1 ratio using Gibson assembly (NEB), before transformation into DH10B electro-competent E ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Genetics 2024Quote: RNP was complexed by addition of 1 μl of 10 uM Cas9 with 3 μl of 10 uM gRNA in 3 μl NebBuffer r3.1 (NEB B6003S) and 20 μl DNAse/RNase free water ...
-
bioRxiv - Cell Biology 2024Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in TTpl503 [mec4p::Lamp-1::GFP]